ID: 1064221869

View in Genome Browser
Species Human (GRCh38)
Location 10:13447968-13447990
Sequence CCTAAGCTGCCCCCCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064221869_1064221872 4 Left 1064221869 10:13447968-13447990 CCACTCCTGGGGGGCAGCTTAGG No data
Right 1064221872 10:13447995-13448017 CTTGAGAATGAACCTTTCTTTGG No data
1064221869_1064221873 10 Left 1064221869 10:13447968-13447990 CCACTCCTGGGGGGCAGCTTAGG No data
Right 1064221873 10:13448001-13448023 AATGAACCTTTCTTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064221869 Original CRISPR CCTAAGCTGCCCCCCAGGAG TGG (reversed) Intronic
No off target data available for this crispr