ID: 1064221873

View in Genome Browser
Species Human (GRCh38)
Location 10:13448001-13448023
Sequence AATGAACCTTTCTTTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064221868_1064221873 16 Left 1064221868 10:13447962-13447984 CCGGAACCACTCCTGGGGGGCAG 0: 1
1: 0
2: 1
3: 21
4: 164
Right 1064221873 10:13448001-13448023 AATGAACCTTTCTTTGGAGATGG No data
1064221869_1064221873 10 Left 1064221869 10:13447968-13447990 CCACTCCTGGGGGGCAGCTTAGG No data
Right 1064221873 10:13448001-13448023 AATGAACCTTTCTTTGGAGATGG No data
1064221871_1064221873 5 Left 1064221871 10:13447973-13447995 CCTGGGGGGCAGCTTAGGAAATC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1064221873 10:13448001-13448023 AATGAACCTTTCTTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064221873 Original CRISPR AATGAACCTTTCTTTGGAGA TGG Intronic
No off target data available for this crispr