ID: 1064222174

View in Genome Browser
Species Human (GRCh38)
Location 10:13450815-13450837
Sequence CCAGGTTTGCCCACTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064222174_1064222183 0 Left 1064222174 10:13450815-13450837 CCTGTAGAAGTGGGCAAACCTGG No data
Right 1064222183 10:13450838-13450860 GGGGAAATGGGCATTTGTGATGG No data
1064222174_1064222184 1 Left 1064222174 10:13450815-13450837 CCTGTAGAAGTGGGCAAACCTGG No data
Right 1064222184 10:13450839-13450861 GGGAAATGGGCATTTGTGATGGG No data
1064222174_1064222185 26 Left 1064222174 10:13450815-13450837 CCTGTAGAAGTGGGCAAACCTGG No data
Right 1064222185 10:13450864-13450886 TTATTAATAGAAATGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064222174 Original CRISPR CCAGGTTTGCCCACTTCTAC AGG (reversed) Intronic