ID: 1064222183 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:13450838-13450860 |
Sequence | GGGGAAATGGGCATTTGTGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1064222174_1064222183 | 0 | Left | 1064222174 | 10:13450815-13450837 | CCTGTAGAAGTGGGCAAACCTGG | No data | ||
Right | 1064222183 | 10:13450838-13450860 | GGGGAAATGGGCATTTGTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1064222183 | Original CRISPR | GGGGAAATGGGCATTTGTGA TGG | Intronic | ||