ID: 1064222184

View in Genome Browser
Species Human (GRCh38)
Location 10:13450839-13450861
Sequence GGGAAATGGGCATTTGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064222174_1064222184 1 Left 1064222174 10:13450815-13450837 CCTGTAGAAGTGGGCAAACCTGG No data
Right 1064222184 10:13450839-13450861 GGGAAATGGGCATTTGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064222184 Original CRISPR GGGAAATGGGCATTTGTGAT GGG Intronic