ID: 1064222185

View in Genome Browser
Species Human (GRCh38)
Location 10:13450864-13450886
Sequence TTATTAATAGAAATGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064222182_1064222185 8 Left 1064222182 10:13450833-13450855 CCTGGGGGGAAATGGGCATTTGT No data
Right 1064222185 10:13450864-13450886 TTATTAATAGAAATGAGACATGG No data
1064222174_1064222185 26 Left 1064222174 10:13450815-13450837 CCTGTAGAAGTGGGCAAACCTGG No data
Right 1064222185 10:13450864-13450886 TTATTAATAGAAATGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064222185 Original CRISPR TTATTAATAGAAATGAGACA TGG Intronic