ID: 1064223117

View in Genome Browser
Species Human (GRCh38)
Location 10:13458726-13458748
Sequence GGTCCCAGGGGACAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064223108_1064223117 21 Left 1064223108 10:13458682-13458704 CCTAGAGCTTGCAAAGGGACAAG 0: 1
1: 0
2: 0
3: 16
4: 199
Right 1064223117 10:13458726-13458748 GGTCCCAGGGGACAAGCAGAGGG No data
1064223105_1064223117 28 Left 1064223105 10:13458675-13458697 CCAAACTCCTAGAGCTTGCAAAG 0: 1
1: 0
2: 0
3: 21
4: 173
Right 1064223117 10:13458726-13458748 GGTCCCAGGGGACAAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064223117 Original CRISPR GGTCCCAGGGGACAAGCAGA GGG Intronic
No off target data available for this crispr