ID: 1064227931

View in Genome Browser
Species Human (GRCh38)
Location 10:13503957-13503979
Sequence CCTCCTAGGCAGCAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064227931_1064227937 -10 Left 1064227931 10:13503957-13503979 CCCTGCAGCTGCTGCCTAGGAGG 0: 1
1: 0
2: 5
3: 27
4: 294
Right 1064227937 10:13503970-13503992 GCCTAGGAGGAGGGAGTCCTGGG No data
1064227931_1064227942 9 Left 1064227931 10:13503957-13503979 CCCTGCAGCTGCTGCCTAGGAGG 0: 1
1: 0
2: 5
3: 27
4: 294
Right 1064227942 10:13503989-13504011 TGGGGCTCTACTCCACAGCAGGG No data
1064227931_1064227944 25 Left 1064227931 10:13503957-13503979 CCCTGCAGCTGCTGCCTAGGAGG 0: 1
1: 0
2: 5
3: 27
4: 294
Right 1064227944 10:13504005-13504027 AGCAGGGAATGATGAGTGACAGG No data
1064227931_1064227941 8 Left 1064227931 10:13503957-13503979 CCCTGCAGCTGCTGCCTAGGAGG 0: 1
1: 0
2: 5
3: 27
4: 294
Right 1064227941 10:13503988-13504010 CTGGGGCTCTACTCCACAGCAGG No data
1064227931_1064227939 -9 Left 1064227931 10:13503957-13503979 CCCTGCAGCTGCTGCCTAGGAGG 0: 1
1: 0
2: 5
3: 27
4: 294
Right 1064227939 10:13503971-13503993 CCTAGGAGGAGGGAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064227931 Original CRISPR CCTCCTAGGCAGCAGCTGCA GGG (reversed) Intronic
900030059 1:364775-364797 CCACCTAGTCAGCAGCTCCAGGG + Intergenic
900050711 1:593839-593861 CCACCTAGTCAGCAGCTCCAGGG + Intergenic
900243792 1:1628703-1628725 CACCCTGGACAGCAGCTGCAAGG - Exonic
900465765 1:2824779-2824801 CCCCCCAGGCATCAGCTCCAGGG - Intergenic
900611700 1:3547018-3547040 CCCCCCAGCCACCAGCTGCAGGG - Intronic
901447771 1:9318652-9318674 CCTCCGAGGCACCAGCCACACGG - Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
902835093 1:19042035-19042057 CCTCCTACCCAGCAGGTTCAGGG + Intergenic
903013764 1:20348677-20348699 CCTCCCAGGCACCAACTGCCAGG + Intronic
903228310 1:21906404-21906426 CCTCCTTGGCCACAGCTGCCGGG - Intronic
903570064 1:24297729-24297751 CCTCCTCCGAAGCAGCAGCAGGG - Intergenic
903886918 1:26546076-26546098 CTTCCCAGGCACCTGCTGCAAGG - Intronic
905852237 1:41282906-41282928 CCCCTTTGGCAGCAGCTGCTGGG - Intergenic
906500726 1:46340453-46340475 CCTCCTAGGCCGAAATTGCATGG - Exonic
907111438 1:51929993-51930015 CCTCCTAGGCTTCTACTGCATGG - Intronic
907830232 1:58057846-58057868 GCTCCTAGGCAGCTTATGCAAGG - Intronic
909818830 1:80032450-80032472 TCTACTAGACAGCAGCTGCTAGG - Intergenic
910294840 1:85634068-85634090 CCTCCTAGGCTGCAGCACTAAGG - Intergenic
910935482 1:92482823-92482845 CCTCTTGGGCGGGAGCTGCAGGG - Intronic
911191831 1:94956070-94956092 CCTCCAAGGGAGAAGCAGCAAGG + Intergenic
915834795 1:159168186-159168208 CCTCCCGGGCAGGAGCAGCATGG + Intergenic
916366988 1:164040495-164040517 GAACCTAGGCAGCAGCTGCCAGG - Intergenic
918064360 1:181089425-181089447 CCGCCTAGGGGGCAGCCGCAGGG - Exonic
919857110 1:201713492-201713514 CCTCATAGCCTCCAGCTGCATGG + Intronic
920337106 1:205252275-205252297 CCTCCCTGGAAGCAGCTGAAAGG + Intronic
920404828 1:205701361-205701383 ACTCCTAGGCTGCAGCTGAGGGG + Intergenic
1063377217 10:5561542-5561564 CCTCCTTGGCACCTGCTCCAGGG - Intergenic
1063662973 10:8046527-8046549 CCTTCTCGGCAGCAGCCGCTAGG - Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064324063 10:14332387-14332409 CCTCCTTGCCAGCAGGTGCCTGG + Intronic
1066652092 10:37665866-37665888 CCCCCTGGGCAGCAACAGCAGGG + Intergenic
1067275333 10:44828663-44828685 ACTCCGAGCCAGCAGCTGAAGGG + Intergenic
1068666663 10:59683641-59683663 CCTTCTAGGCAGCTTCTACATGG - Intronic
1072611374 10:97019503-97019525 CCTCCTAGTCAGCAGGTGTCAGG - Intronic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1073559897 10:104487692-104487714 CCTCAAAGGCACCAGCTGTAGGG + Intergenic
1074392732 10:113071591-113071613 CGTTCTGGGCAGCAGCTGTAGGG + Intronic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1077245817 11:1537508-1537530 CCTCTGAGGCAGCAGCTCCAAGG + Intergenic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078397401 11:10993251-10993273 GGTCCAAGGCAGAAGCTGCAAGG + Intergenic
1080040270 11:27752828-27752850 GTTCTTAGGCAGCAGCTGAAAGG - Intergenic
1080681687 11:34482743-34482765 CCTCCTAGGAAGGCCCTGCACGG - Intronic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1083160571 11:60851724-60851746 CTTCCAAGGCAGAAGCAGCAGGG - Exonic
1084154123 11:67304212-67304234 CGTCCTGGGCTCCAGCTGCAGGG + Intronic
1084174522 11:67416349-67416371 CCTCCCAGGATGCAGCCGCAGGG - Intronic
1084273113 11:68039360-68039382 CCTCCAAGGAAGCAGCAGCGGGG - Intronic
1084390722 11:68874992-68875014 GCTCCTGGGCAGCGGCCGCATGG - Intergenic
1084945518 11:72636213-72636235 CATCAGAGGCAGCAGCTTCAAGG + Intronic
1085287087 11:75370100-75370122 CCTCCTAGGAAGCAGAGGCTGGG - Intergenic
1086167651 11:83798065-83798087 CCTTCTAAGCAGCATCTCCAAGG - Intronic
1087007793 11:93486302-93486324 CCTCCCTGGAAGCAGCTGCTTGG - Intronic
1089351231 11:117822703-117822725 TCTCCTAGGCGGCAGCCCCAAGG - Exonic
1089456291 11:118627825-118627847 CCGCCAAGACAGTAGCTGCAGGG - Exonic
1089621084 11:119722605-119722627 CTACCTAGGCAGCAGGTGCTGGG - Intronic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1091819634 12:3466074-3466096 CCTCCTCCACAGCAGGTGCAGGG - Intronic
1092533338 12:9363432-9363454 CCTCCTCCACAGCAGGTGCAGGG + Intergenic
1097164861 12:57078589-57078611 CCCCCTTGGCAGCTGCTGCCCGG + Intronic
1097780995 12:63704225-63704247 CCTCCTAGACTCCAGCTGCGTGG - Intergenic
1099520895 12:83660738-83660760 TCTCCTAGGCAGCAGTAGAAAGG + Intergenic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1104034925 12:125091569-125091591 CATCCTGGGCAGGGGCTGCATGG + Intronic
1106173658 13:27309768-27309790 CCTCTGAGGCATCAGCCGCAGGG + Intergenic
1106758147 13:32842796-32842818 TCTCCAACACAGCAGCTGCATGG - Intergenic
1108979049 13:56487164-56487186 CTGCCTAGGCAACAACTGCACGG - Intergenic
1111093609 13:83479640-83479662 CTTCCTGGGCAGTATCTGCAGGG - Intergenic
1111649026 13:91066434-91066456 CCCCCAAGTCTGCAGCTGCATGG - Intergenic
1112409734 13:99152735-99152757 ATTCCCAGGCAGAAGCTGCAAGG - Intergenic
1112819527 13:103315115-103315137 CCTCCCAGTTTGCAGCTGCAGGG - Intergenic
1113397959 13:109966114-109966136 CATCCTAGGCTGCAACTGGATGG - Intergenic
1115204371 14:30886287-30886309 CATCATGTGCAGCAGCTGCAGGG - Exonic
1117523063 14:56570272-56570294 AGGCCTAGGCAGAAGCTGCAAGG - Intronic
1118200187 14:63664028-63664050 CCGCCCAAGCTGCAGCTGCAGGG - Intergenic
1121137311 14:91510317-91510339 CCACCCAGGGAGCAGCTGCAGGG + Intronic
1121680795 14:95791294-95791316 TCTCCCAGGCAGCAGCTGATAGG + Intergenic
1122061109 14:99137255-99137277 CCTCCTGGGCTACAGCAGCAGGG + Intergenic
1122146990 14:99697206-99697228 GCTCCTACGCAGCATCTGCATGG - Intronic
1123146224 14:106133185-106133207 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123186464 14:106522234-106522256 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1202943079 14_KI270726v1_random:1267-1289 ACTCCTCTGCAGCAGCTCCAGGG - Intergenic
1124158768 15:27250869-27250891 CCTCCTGGGCAGCACCCGCTGGG + Intronic
1127084005 15:55408095-55408117 CCTCCTAGGCTGGGGCTGCTCGG - Intronic
1128684110 15:69671134-69671156 CCACCAAAGCAGCAGCTGCCAGG + Intergenic
1129175637 15:73837970-73837992 CTTCCTGGGGAGGAGCTGCAAGG - Intergenic
1129895508 15:79102786-79102808 GCACCTAGGCAGGGGCTGCAAGG - Intergenic
1130956255 15:88629398-88629420 CTTCTTGTGCAGCAGCTGCAGGG - Exonic
1132120984 15:99175189-99175211 CATACTTGGCAGCAGCAGCAGGG + Intronic
1132508980 16:327419-327441 CCTCCTAGGCACAGGCCGCAGGG - Intronic
1132643612 16:988951-988973 CCTCCCAGGCAGCTGCTGGGAGG - Intergenic
1132783881 16:1643662-1643684 CCTCCCGGGCAGCAGGTGCGTGG + Intronic
1133592585 16:7260533-7260555 CCTCCAAGGCTGCATCTTCAGGG + Intronic
1134124266 16:11605509-11605531 ACTCCTAGGCAGGGGCCGCAAGG + Intronic
1134900915 16:17937020-17937042 CCCCCTATGCAGAAACTGCACGG + Intergenic
1136458371 16:30395221-30395243 CCTCCTGGGCTGCAGCTGGGTGG - Exonic
1138135764 16:54521012-54521034 CCTCTTAGGCAGTAGTTACACGG - Intergenic
1138565029 16:57826960-57826982 GTCCCAAGGCAGCAGCTGCAGGG - Intronic
1138806941 16:60100958-60100980 CATCCCCAGCAGCAGCTGCATGG - Intergenic
1140794820 16:78427463-78427485 CCTCAATGGCTGCAGCTGCATGG + Intronic
1141159015 16:81616936-81616958 CCTCCTGGGCCCCAGCTGCCTGG - Intronic
1141645456 16:85365020-85365042 CTTCCTACAGAGCAGCTGCAGGG - Intergenic
1142868995 17:2808540-2808562 CGGCCTGGGAAGCAGCTGCACGG + Intronic
1146063480 17:29618837-29618859 CCTGCTAGCCACCACCTGCAAGG - Exonic
1146281700 17:31549405-31549427 CCTCCTTGCCAGGGGCTGCAAGG + Intergenic
1146284432 17:31564994-31565016 TCTCCTGGGCAGCAAATGCAAGG - Intergenic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1148064983 17:44862613-44862635 CCTCCTTGGAAGTAGTTGCAAGG - Intronic
1148088709 17:45009783-45009805 CCTCCTGGTCAGCAGCTGTAGGG + Intergenic
1148693492 17:49545953-49545975 CCTCCATGGCAGCAGCAGCTGGG - Intergenic
1148876911 17:50693601-50693623 CCTCCAGAGGAGCAGCTGCAGGG - Exonic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1150651996 17:67016407-67016429 CCTTGGAGGCAGCAGCTGAAGGG + Intronic
1150870887 17:68910268-68910290 CATCCTTGGCAGCAGCTGTGTGG + Intronic
1151402999 17:73868388-73868410 CCTCCTAGGAAGCTGCTCGAGGG - Intergenic
1151460160 17:74249611-74249633 GCTCCTGGACAGCATCTGCATGG - Intronic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1151872171 17:76843894-76843916 CCTCCCAGACAGCAGCCACATGG - Intergenic
1152688133 17:81704695-81704717 CCTCCTGGGCTGCTGCAGCAGGG - Exonic
1152770255 17:82163150-82163172 CCTCCTAGAGAGCCGCTGCTGGG - Intronic
1152790166 17:82274373-82274395 CCCCCCAGGCTGCAGGTGCATGG + Intergenic
1152949698 17:83221785-83221807 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1156898886 18:42277713-42277735 CTCCCTAGGCAGCAACTCCAAGG + Intergenic
1157239391 18:45995652-45995674 CCTCCAAGACAGCAGCTGCAGGG + Intronic
1157551916 18:48588143-48588165 CCTCCTAAGTGGCAGCTCCATGG + Intronic
1159864653 18:73689966-73689988 CCTCCGAGGCTGTGGCTGCATGG - Intergenic
1160529447 18:79555028-79555050 CCTGCAAGGCAGCCGCTGCTGGG + Intergenic
1161388704 19:4010225-4010247 CCTCCGAGGTGGCAGCTGCTGGG + Intronic
1161515185 19:4692530-4692552 TCTCCTAGACAGCAGCTGCATGG - Intronic
1161769813 19:6225117-6225139 CTTGCCTGGCAGCAGCTGCAGGG - Intronic
1163156126 19:15440701-15440723 CCTCCATCCCAGCAGCTGCAAGG + Intronic
1164733259 19:30521539-30521561 CCTCCTGGGTAGCAGCTTCCAGG - Intronic
1165665157 19:37621844-37621866 AGTCCTAAGCAGCTGCTGCATGG + Intronic
1165708312 19:37991846-37991868 ACTCCAAGCCATCAGCTGCAAGG - Intronic
1165900725 19:39168057-39168079 CACCCTGGGCAGCTGCTGCATGG + Intronic
1166641859 19:44500422-44500444 TCTCCTAGTCAGCATCCGCAAGG + Exonic
1167015454 19:46838338-46838360 CCTCCTAGGCAGCTGAGGGAAGG + Exonic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1167582309 19:50352503-50352525 CATCCCTGGCAGTAGCTGCATGG - Intronic
925014161 2:509270-509292 CGTCCTTGGCAGCATCTGTATGG - Intergenic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925814178 2:7731400-7731422 CCTCTCAGGTAGCAGCTGGAAGG + Intergenic
926042656 2:9686499-9686521 CCTTCTAGGCACCAGGTTCAAGG - Intergenic
926213607 2:10889961-10889983 CTGCCTAGGCTGCAGCAGCATGG - Intergenic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
926971745 2:18473605-18473627 CCTCTGAGACAGCAGCAGCATGG - Intergenic
928022762 2:27716432-27716454 CCTCCAGGGCTGCAGCTGCTCGG - Intergenic
930091629 2:47535216-47535238 CCTCCCTGGCTGCAGCTGAAAGG - Intronic
932460028 2:71876078-71876100 CCTCCCAGCCAGAACCTGCAGGG + Intergenic
934615502 2:95768240-95768262 TCTCCAAGGCAGCACCTGCCAGG - Intergenic
934645398 2:96056318-96056340 TCTCCAAGGCAGCACCTGCCAGG + Intergenic
934838802 2:97612407-97612429 TCTCCAAGGCAGCACCTGCCAGG + Intergenic
935244582 2:101207122-101207144 CCTGGGAGGCAGCAGTTGCAGGG - Intronic
936284630 2:111172827-111172849 CCTGCAAGGCAGCAGGTGCGTGG - Intergenic
937313393 2:120915851-120915873 GCTTCTGAGCAGCAGCTGCAAGG - Intronic
937986493 2:127640435-127640457 CCTCCCAGGGCCCAGCTGCAAGG + Intronic
939264499 2:139853683-139853705 TGTCCCAGGCAGAAGCTGCAAGG + Intergenic
941732573 2:168934550-168934572 CCTCCTAGGCAGAGACAGCATGG - Intronic
942596143 2:177593606-177593628 CTTCAAAGGCAGCAGCTCCAAGG - Intergenic
943004324 2:182371081-182371103 CATCCAAAGCAGCAGCTGGATGG + Intronic
946312849 2:218892494-218892516 CCGCCTTTCCAGCAGCTGCAGGG - Intronic
946334307 2:219027342-219027364 CCTCCTAGCCAGGAGCCCCAGGG + Intronic
946337058 2:219044906-219044928 CCTCCAAAACAGTAGCTGCAGGG - Intergenic
946982560 2:225233401-225233423 CCTCCCAGGCTACAGTTGCATGG + Intergenic
947452257 2:230219791-230219813 ACTTCGCGGCAGCAGCTGCAGGG - Intronic
948025635 2:234773914-234773936 CCATCCAGGCAGCAGTTGCATGG - Intergenic
948145211 2:235703485-235703507 CCTCCTTGGCAGCATCTCCTTGG + Intronic
948563146 2:238867141-238867163 CCTCGAAGCCAGCAGCTGGAGGG + Intronic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1173527622 20:43745119-43745141 GCTCCCAGGCACCAGCAGCAAGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174157891 20:48528512-48528534 CCGCCTGGGCAGCTGCTGCAAGG - Intergenic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174566743 20:51470103-51470125 CATGATAGACAGCAGCTGCAAGG - Intronic
1174938411 20:54897649-54897671 ACCCCTCAGCAGCAGCTGCATGG + Intergenic
1177078346 21:16607006-16607028 CCTCAAAGGCAGCAGCCTCAAGG + Intergenic
1177228395 21:18286846-18286868 CCTTCTGGGCAACAGCAGCAGGG + Intronic
1177740734 21:25149547-25149569 ATTCCTAGGCAGCAGCTGCATGG - Intergenic
1177816412 21:25982153-25982175 CTTCCTAGGCAGCATGTTCACGG + Intronic
1178098553 21:29241244-29241266 CCTACACAGCAGCAGCTGCAAGG - Intronic
1178915700 21:36704649-36704671 CCTCGGAGCCAGCAGCTGCTGGG + Intronic
1179533531 21:42036274-42036296 CTTCCTAGAAAGGAGCTGCAGGG - Intergenic
1179567908 21:42260648-42260670 GCTCCTTGGCAGGAGCTGCTTGG - Intronic
1179884606 21:44308284-44308306 CCCACTAGGCAGCAGATTCAGGG - Intronic
1179955601 21:44736550-44736572 TGTCCTAGCCAGCAGCAGCAGGG + Intergenic
1181038850 22:20182486-20182508 CCTCCCAGGGCTCAGCTGCAAGG - Intergenic
1181163586 22:20971759-20971781 CCTCCCAGGCTGCTGCTGCAGGG - Intronic
1181422846 22:22813841-22813863 CCTCCTAGGCAGCTGGTCCCAGG + Intronic
1181892647 22:26077362-26077384 CCTCCCTGGGAGCAGCTGCAGGG + Intergenic
1182298774 22:29326687-29326709 CTGCCTGGGAAGCAGCTGCACGG - Intergenic
1183489135 22:38107510-38107532 CCTCCCAGGGAGCAGCCACATGG - Intronic
1184684022 22:46087949-46087971 CCTCCAGGGCTGCAGCTGCAGGG + Intronic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
1184863718 22:47191212-47191234 CCACCAAGTCAGCAGCTGCTAGG + Intergenic
1185384222 22:50524391-50524413 GCTCCGAGTCAGCAGCAGCATGG + Exonic
949826558 3:8171583-8171605 TCTCTTAGGCAGTAGGTGCAAGG - Intergenic
950695776 3:14700104-14700126 CATCCCCAGCAGCAGCTGCAAGG - Intronic
953328453 3:42032325-42032347 CTTCCCAGGCAGTGGCTGCAAGG + Intronic
953472720 3:43180704-43180726 CCCCATGGGCAGCATCTGCAAGG + Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954422095 3:50424224-50424246 CCTCTTAGGCAGGTGCAGCATGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955360362 3:58268955-58268977 GATCCAAGTCAGCAGCTGCATGG + Intronic
961512165 3:127409689-127409711 CCTCCCAGCCCACAGCTGCATGG + Intergenic
961685834 3:128630116-128630138 CATCCTGGGCAGCAGCAGGAAGG + Exonic
963692160 3:148518626-148518648 CAACTTAGGCAGCAGCTGCCTGG + Intergenic
963844401 3:150140801-150140823 CCTCCACGCCTGCAGCTGCATGG + Intergenic
967997973 3:195180784-195180806 CCTCCTCGGGAGAAGCTCCAAGG + Intronic
968059273 3:195714640-195714662 ACTCCTATGCTGCAGCTGAATGG + Intergenic
968504726 4:966571-966593 CCACCTTGGAAGCAGCTGCCCGG + Intronic
968579915 4:1385060-1385082 CCTCCTGGGCATCAGCACCAAGG - Intronic
968656900 4:1782610-1782632 CCGCCTGGGCAGCTGCTTCAGGG + Intergenic
968757756 4:2425778-2425800 CCCCCTAGGCAGCTTCTCCAAGG + Intronic
968871930 4:3246709-3246731 CCTCCCAGGCAGGAGCAGCTGGG + Intronic
969046581 4:4340878-4340900 CCTACTTGGCAGCAGCCACATGG - Intergenic
969299978 4:6292030-6292052 CCTCCCAGCCTGCACCTGCAGGG + Intronic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
969467563 4:7366625-7366647 CCTCCCATGCAGCTGCTCCAAGG + Intronic
969608214 4:8212707-8212729 CCGCACAGCCAGCAGCTGCAGGG - Exonic
969940352 4:10725446-10725468 CCTCCTTCACAGCATCTGCAAGG + Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
976486697 4:85613813-85613835 CCTCCTAGAAAGGAGCTTCATGG + Intronic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
978754881 4:112291171-112291193 CTTCGTAGGCAGCTCCTGCATGG - Intronic
979122909 4:116926208-116926230 CCTCTCGGGCAGCGGCTGCAGGG + Intergenic
983630174 4:169842017-169842039 ACTCCTTGGCAGCAGCAGGATGG + Intergenic
985604249 5:850020-850042 CCTCCTTGGCACCAGGGGCAAGG + Intronic
986611081 5:9567918-9567940 CCTCTTTGGCAGCAGCTGTGAGG - Intergenic
986641492 5:9876077-9876099 CCTCCTGGGCTGCAGATGCTAGG - Intergenic
986674305 5:10169613-10169635 CGTCATAGTCAGCATCTGCATGG + Intergenic
987069083 5:14318888-14318910 CTTCCGAGGCAGCAGCAGCAAGG + Intronic
987741976 5:21920948-21920970 CCTCCTCTGCAGCAGATGCTTGG + Intronic
990063593 5:51683436-51683458 ACTCCTGGGCAGCATCTGGAAGG - Intergenic
990465939 5:56071597-56071619 ACTGCCAGGAAGCAGCTGCAAGG - Intergenic
992080632 5:73232551-73232573 CCGTCTGGGCTGCAGCTGCAGGG + Intergenic
992202295 5:74396304-74396326 CCACCTTGGCAGCAGCTGAGGGG - Intergenic
993362662 5:86997518-86997540 AATCCTAGGCAGCTGCAGCATGG - Intergenic
993443900 5:87988968-87988990 CCTCCTTGGCAGCATCTAAAGGG + Intergenic
994428830 5:99628920-99628942 CACCCCAGGCAGCAGCAGCAAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996962690 5:129270078-129270100 TCTCAAAGGCAGCAGCAGCACGG + Intergenic
997355145 5:133257702-133257724 CCTCCTGGTCAGCAGGAGCATGG + Intronic
997935899 5:138110705-138110727 CGTCCTGGGCAGCAGCTGCAGGG - Intergenic
997962766 5:138335203-138335225 CCTCCCAGCCAGCCTCTGCAGGG + Intronic
998471389 5:142386557-142386579 CCTCCCAGGAAGCAGGGGCAAGG + Intergenic
999720506 5:154395937-154395959 CCTCATCGGAAGCACCTGCAGGG - Intronic
1001524559 5:172419371-172419393 CCTCCTCGGCAACAGCTGACAGG + Intronic
1001831487 5:174793204-174793226 CCACCCAGTCAGCAGGTGCAAGG - Intergenic
1002259171 5:177982253-177982275 CCTCCAAGGAAGCAGCAGCCAGG + Intergenic
1002291629 5:178204582-178204604 CCTCCTTGGCCGCCGCCGCACGG - Exonic
1002743930 5:181455597-181455619 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1003891390 6:10566647-10566669 CTTCAAGGGCAGCAGCTGCACGG + Intronic
1004258156 6:14084118-14084140 CCTCCCAGGCAGGAGCTTCAAGG - Intergenic
1004310535 6:14541069-14541091 TCTGCGAGGCAGCAGCTGAAGGG - Intergenic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1008848695 6:55997766-55997788 ACCCCCTGGCAGCAGCTGCATGG - Intergenic
1009412517 6:63382542-63382564 CCTCCTAGGTAACACATGCATGG - Intergenic
1011310009 6:85971450-85971472 TATGCTAAGCAGCAGCTGCAAGG + Intergenic
1013318861 6:108967284-108967306 CCGCATAGGCAGCAGCTACCGGG + Intronic
1016180419 6:141139675-141139697 CTGCCCAGGCGGCAGCTGCACGG - Intergenic
1016714150 6:147204291-147204313 CCTCCGAGGCCGCCGCTGCTTGG - Intergenic
1017041955 6:150315107-150315129 CTTCCAAGGAAACAGCTGCAGGG + Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1019190596 6:170248607-170248629 CCTCCGAGGCAGCTGCAGCCTGG + Intergenic
1019248789 6:170728826-170728848 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1019637886 7:2086108-2086130 CCTCCTGGCCAGCAGCCCCAAGG + Intronic
1020100412 7:5391189-5391211 TCTCCCAGGCAGGAGCTGCCAGG + Intronic
1020278401 7:6637766-6637788 CCTTCTCGGCCGCAGCGGCAGGG + Intronic
1020524577 7:9242745-9242767 CATACAAGGCAGCCGCTGCATGG + Intergenic
1024506407 7:50165840-50165862 CCTCCCAGGAAGCAGCCTCATGG + Intergenic
1024678792 7:51661882-51661904 CCTCCTTGGCAGCACCTCCGTGG - Intergenic
1024699098 7:51887640-51887662 GCTTTTAGGCAGCCGCTGCACGG + Intergenic
1029167144 7:98600433-98600455 CTTCCGAGGCAGCAGATCCAAGG - Intergenic
1032402008 7:131630158-131630180 GATCCCAGGCAGCAGCTGAAAGG - Intergenic
1032616692 7:133480282-133480304 CCTGCTTGGCAGCAGATGCTGGG - Intronic
1033176951 7:139133673-139133695 CTTCCGCGGCAGAAGCTGCACGG + Intergenic
1033229171 7:139583344-139583366 CCTCCTCGGAATCAGCTGCTGGG - Intronic
1034275704 7:149822939-149822961 CCTCCTAGAGGGCAGCTACATGG - Intergenic
1035441230 7:158902736-158902758 CCTCCTATGTGGTAGCTGCAAGG - Intronic
1035499256 8:78509-78531 CCACCTAGTCAGCAGCTCCAGGG + Intronic
1036692195 8:10951117-10951139 CTTCCTGGGCACCTGCTGCAAGG - Intronic
1037944755 8:22981876-22981898 CCGCCCAGGCTGCAGCAGCAAGG - Intronic
1040739731 8:50558231-50558253 GCTCCATGGCAGCAGCTGCATGG + Intronic
1041180250 8:55239815-55239837 CCTCCTACACACCAGTTGCATGG + Intronic
1041510673 8:58651817-58651839 ATTCCAAGGCAGCAGCTTCAGGG + Intronic
1046272741 8:111917321-111917343 CTTCCAAGGCTGCAGTTGCACGG + Intergenic
1048377514 8:133835498-133835520 CCTCACAGGCAGCATCTCCAGGG - Intergenic
1049090466 8:140510638-140510660 CCTCCCAGCCGGCAGCTGCAGGG + Intergenic
1049291732 8:141806912-141806934 CCTCCCAGGCCCCAGCTGGATGG - Intergenic
1049437042 8:142591429-142591451 CCGCCTTGGCACAAGCTGCAAGG + Intergenic
1049744191 8:144256290-144256312 CCTCCTGGGCAGGTGCGGCATGG - Intronic
1049985591 9:947969-947991 CCTCCCAGTCAGCAGCAGCAAGG - Intronic
1051516743 9:17938216-17938238 CCTCCCTGACAGCAGCTCCATGG - Intergenic
1051922797 9:22287559-22287581 CCTCATAGGAATCACCTGCAGGG + Intergenic
1052917056 9:33931462-33931484 GCTCCCAGGCAGCAGTGGCACGG + Intronic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1059242601 9:112820011-112820033 CCTCACAGGCACCAGCTGCCAGG - Intronic
1059250008 9:112879975-112879997 CCTTTTAGCTAGCAGCTGCAGGG - Intronic
1059501662 9:114759495-114759517 ACACCTAGGCAGAAGCTACAGGG - Intergenic
1059709887 9:116857915-116857937 GTGCCTAGGCAGAAGCTGCAAGG - Intronic
1060135200 9:121147076-121147098 CCCCGGAGGCAGCAGTTGCAAGG - Intronic
1060978418 9:127778847-127778869 CCTCCTTGGCCTCAGCAGCAGGG + Intergenic
1061389310 9:130308533-130308555 GGTCCCAGGCAGCTGCTGCAAGG - Intronic
1061424053 9:130488356-130488378 CCACCCAGACAGCAGCTGCAGGG + Intronic
1062000036 9:134211343-134211365 CCAACTAGGCCGCAGCTCCACGG + Intergenic
1062065088 9:134522376-134522398 CCTCCTAAGCAGCCTCTGCCAGG - Intergenic
1062075493 9:134586404-134586426 CCTCCTAGGCAGCTGGGACATGG + Intergenic
1062445481 9:136592277-136592299 CCCCCTAGGCTGCAGCTGTCTGG - Intergenic
1203609745 Un_KI270748v1:86090-86112 CCACCTAGTCAGCAGCTCCAGGG - Intergenic
1185890259 X:3816182-3816204 CCTCCCAGGCAGCGACCGCAGGG - Intergenic
1186151435 X:6678711-6678733 CCTCCAAGTTATCAGCTGCAAGG + Intergenic
1187346583 X:18470831-18470853 CCACAGAGGCAGCAGCTACACGG - Intronic
1187505798 X:19877377-19877399 CCTCTTAGCCAGCATCTTCATGG - Intronic
1195085865 X:101413219-101413241 CCTGCTAGCCAGCAGCTGAGTGG + Exonic
1195218308 X:102721856-102721878 CATCCTAGGTAGCAGCCCCATGG + Intronic
1196904505 X:120418565-120418587 TCCCCAAGGCAGCTGCTGCAAGG + Intergenic
1197263010 X:124336676-124336698 CCCCCAAGGCAGCTGCTGCAAGG + Intronic
1198859682 X:141055885-141055907 CACCCTGGGTAGCAGCTGCATGG - Intergenic
1198903011 X:141531505-141531527 CACCCTGGGTAGCAGCTGCATGG + Intergenic
1199085738 X:143629099-143629121 CTTCCTTAGCTGCAGCTGCATGG + Exonic
1200235015 X:154463943-154463965 CCTTCGCGGCAGCACCTGCACGG - Exonic
1200826476 Y:7650014-7650036 TCTCCCAGACAGCAACTGCATGG - Intergenic
1202386407 Y:24330816-24330838 CATCCAAGCCAGCAGCTGCTAGG + Intergenic
1202484379 Y:25339312-25339334 CATCCAAGCCAGCAGCTGCTAGG - Intergenic