ID: 1064233296

View in Genome Browser
Species Human (GRCh38)
Location 10:13549003-13549025
Sequence CCCCCCTAAAAAAAAACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064233296_1064233307 28 Left 1064233296 10:13549003-13549025 CCTTAGGTTTTTTTTTAGGGGGG No data
Right 1064233307 10:13549054-13549076 TACTAAAACCCTTAATATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064233296 Original CRISPR CCCCCCTAAAAAAAAACCTA AGG (reversed) Intergenic
No off target data available for this crispr