ID: 1064233307

View in Genome Browser
Species Human (GRCh38)
Location 10:13549054-13549076
Sequence TACTAAAACCCTTAATATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064233294_1064233307 29 Left 1064233294 10:13549002-13549024 CCCTTAGGTTTTTTTTTAGGGGG No data
Right 1064233307 10:13549054-13549076 TACTAAAACCCTTAATATCTAGG No data
1064233303_1064233307 4 Left 1064233303 10:13549027-13549049 CCTGGGGGGTAAACCACAAATTC No data
Right 1064233307 10:13549054-13549076 TACTAAAACCCTTAATATCTAGG No data
1064233296_1064233307 28 Left 1064233296 10:13549003-13549025 CCTTAGGTTTTTTTTTAGGGGGG No data
Right 1064233307 10:13549054-13549076 TACTAAAACCCTTAATATCTAGG No data
1064233304_1064233307 -9 Left 1064233304 10:13549040-13549062 CCACAAATTCCCTATACTAAAAC No data
Right 1064233307 10:13549054-13549076 TACTAAAACCCTTAATATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064233307 Original CRISPR TACTAAAACCCTTAATATCT AGG Intergenic
No off target data available for this crispr