ID: 1064242949

View in Genome Browser
Species Human (GRCh38)
Location 10:13647136-13647158
Sequence GAAAGACTCGTGATTAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064242949_1064242956 30 Left 1064242949 10:13647136-13647158 CCTGTGCTAATCACGAGTCTTTC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1064242956 10:13647189-13647211 AACAGTGCTGTGTGTACAGAAGG 0: 1
1: 0
2: 1
3: 23
4: 240
1064242949_1064242951 -5 Left 1064242949 10:13647136-13647158 CCTGTGCTAATCACGAGTCTTTC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1064242951 10:13647154-13647176 CTTTCCTGTTCGGAGCAGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064242949 Original CRISPR GAAAGACTCGTGATTAGCAC AGG (reversed) Intronic
903967413 1:27099328-27099350 GAGAGACTCTTGATTAGGAGTGG + Exonic
905061159 1:35140201-35140223 GCAAGACTCCTGGTTGGCACTGG + Intergenic
905869878 1:41397192-41397214 GAAGGACACGTGATTCACACTGG + Intergenic
910852959 1:91666554-91666576 GCAAGACTCCTGGTTGGCACTGG + Intergenic
913050879 1:115115592-115115614 GACAGACTTGTGCTGAGCACTGG - Intergenic
913136673 1:115897511-115897533 GCCAGCCTCGTGATTAGCAAGGG + Intergenic
915155835 1:153875244-153875266 AAAAGACTCTTGATTAGACCAGG + Intronic
917311760 1:173686042-173686064 GCAAGACTCCTGATTGACACTGG + Intergenic
918275307 1:182948392-182948414 AATAGACTCGTGATTAGAATGGG - Intronic
921074638 1:211690474-211690496 GCAAGACTCCTGGTTGGCACTGG - Intergenic
922680774 1:227593486-227593508 GCAAGACTCCTGGTTGGCACTGG + Intronic
922690152 1:227682619-227682641 GCAAGACTCCTGGTTGGCACTGG - Intergenic
923301173 1:232642177-232642199 GAAACAGTCTTGAATAGCACAGG - Intergenic
924859076 1:247902430-247902452 GCAAGACTCCTGGTTGGCACTGG + Intergenic
1064242949 10:13647136-13647158 GAAAGACTCGTGATTAGCACAGG - Intronic
1065931003 10:30479086-30479108 GCAAGACTCCTGGTTGGCACTGG - Intergenic
1068917608 10:62449319-62449341 GAAAGGCTTGTGATTAGAATGGG + Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1103781555 12:123402249-123402271 GAAAGCCTGGTGACTAGCAAGGG + Intronic
1105270410 13:18869434-18869456 GGAAGAGTTGTGATTAGCCCAGG + Intergenic
1110653714 13:77972529-77972551 GCAAGACTCCTGGTTGGCACTGG + Intergenic
1113458777 13:110467372-110467394 GGAAGCCTCGTGTTTAGGACTGG + Intronic
1115425095 14:33249414-33249436 GCAAGACTCCTGAATAGCACTGG + Intronic
1115745133 14:36428886-36428908 GCCAGACTCTTGATAAGCACTGG + Intergenic
1117363853 14:55005287-55005309 GAGAGGCTGGTGATCAGCACTGG + Intronic
1130826756 15:87556804-87556826 GAAAGTCTCATGGTTAGCAAAGG + Intergenic
1131011124 15:89019314-89019336 GAATGAGTCCTGATTAGCAGAGG - Intergenic
1135789519 16:25380634-25380656 CAGAGACTCATGATTAGCTCAGG - Intergenic
1137711234 16:50568270-50568292 GGAAGAGACGTGGTTAGCACTGG + Intronic
1140792249 16:78403103-78403125 GAAAGAGTCGTCATTGGCAAGGG + Intronic
1146764158 17:35504253-35504275 GCAAGACTCCTGATTGACACTGG - Intronic
1149561165 17:57608897-57608919 GAAAGGCTTGTGATTGGCAGAGG + Intronic
1151250540 17:72830644-72830666 AAAAGACTCAGGATAAGCACTGG - Intronic
1154014137 18:10601502-10601524 GTAAGACTCCTGGTTGGCACTGG + Intergenic
1156649580 18:39209238-39209260 GAAAGACTGGTGTTTAGGACAGG + Intergenic
1158495806 18:57954349-57954371 GATAGACACGTGAACAGCACTGG - Intergenic
1158917210 18:62145683-62145705 GAAAGTCTAGTTATTAGCAGTGG + Intronic
1161069792 19:2254301-2254323 GAATGTCTCGTGATAACCACAGG - Exonic
926491459 2:13530061-13530083 GCAAGACTCCTGGTTGGCACTGG + Intergenic
927069186 2:19507880-19507902 GAAAGACTGTTGATTAGTAAAGG - Intergenic
927660000 2:24985108-24985130 GGAAGACTCGTGGTGAGCAGGGG - Intergenic
928470856 2:31574097-31574119 GAAAGAAGCCTGGTTAGCACGGG - Intronic
929583803 2:43101249-43101271 GAAAGCCTCGTGATTTCCATGGG + Intergenic
940145250 2:150539110-150539132 CAAAGTCTCGTGATGAGCAGCGG + Intergenic
941761125 2:169244757-169244779 GATACACTGGTGATTATCACAGG + Exonic
948749907 2:240125766-240125788 GAAAGACTTCTGAATAACACTGG - Intergenic
1169534338 20:6521656-6521678 GAATGACTGGTGATTACCAGGGG - Intergenic
1175470122 20:59221624-59221646 GCAAGACTCCTAATTAGGACAGG - Intronic
1176855682 21:13968738-13968760 GGAAGAGTTGTGATTAGCCCAGG + Intergenic
1181927348 22:26370597-26370619 GAAATTCAGGTGATTAGCACTGG - Intronic
1184170884 22:42759126-42759148 AAAGGACTCTTGATTGGCACTGG - Intergenic
951124356 3:18966343-18966365 GAAACAGTCCTGATTAGCATTGG - Intergenic
953934507 3:47028763-47028785 GACAGACTCCTGAGAAGCACAGG + Intronic
957999924 3:87737675-87737697 GCAAGACTCCTGGTTGGCACTGG + Intergenic
972217052 4:36909259-36909281 GCAAGACTCCTGGTTGGCACTGG - Intergenic
973981045 4:56308618-56308640 GAAAGACGAGTGATTTGCAGAGG + Intronic
981812543 4:148792101-148792123 GAAAGACTCTAGAATAGCAGAGG - Intergenic
983708435 4:170686722-170686744 GCAAGACTCCTGGTTGGCACTGG - Intergenic
983897968 4:173102136-173102158 GCAAGACTCCTGGTTGGCACTGG - Intergenic
985094211 4:186396704-186396726 GAAAGAATGGTGATTACCAGGGG - Intergenic
995867423 5:116706605-116706627 GCAAGACTCCTGGTTGGCACTGG - Intergenic
996040502 5:118804674-118804696 GGTAGACTCGTGATTACCAGAGG + Intergenic
998760947 5:145431200-145431222 GAAAGACTAGTGATTGGGAGTGG - Intergenic
999538129 5:152541149-152541171 GAGAGACTCGTGTTTGGCCCAGG - Intergenic
999664647 5:153899796-153899818 GCAAAACTTGTGATTATCACAGG - Intergenic
1005680769 6:28205991-28206013 GGAAGACTCCCAATTAGCACAGG + Intergenic
1010701289 6:79051090-79051112 GAAAGACCTGTTATTAACACGGG + Intronic
1020043896 7:5025280-5025302 GCAAGACTCCTGGTTGGCACTGG + Intronic
1021849361 7:24792352-24792374 GCAAGACTCCTGGTTAACACTGG + Intergenic
1188532807 X:31161492-31161514 GAAAAACTCCTGATTTGCAAAGG - Intronic
1191639233 X:63412603-63412625 GTAAGACTCCTGGTTGGCACTGG - Intergenic
1192268091 X:69554200-69554222 TAAGGACTCGTGATTAGATCAGG - Intergenic
1192453786 X:71260714-71260736 GAAAGAGTCCTCATAAGCACAGG - Intergenic
1195145248 X:102007823-102007845 GAAAGACTCATGATTAGTAAAGG + Intergenic
1199638351 X:149835135-149835157 GCAAGACTCCTGGTTAACACTGG - Intergenic
1201227470 Y:11832137-11832159 AAAAGACCCGTCATTAGTACCGG + Intergenic