ID: 1064245676

View in Genome Browser
Species Human (GRCh38)
Location 10:13666036-13666058
Sequence GCGTCTGGTTGCCGGGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064245669_1064245676 -7 Left 1064245669 10:13666020-13666042 CCACTCGTGGGACCTGGCGTCTG 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1064245676 10:13666036-13666058 GCGTCTGGTTGCCGGGGCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064245676 Original CRISPR GCGTCTGGTTGCCGGGGCCC GGG Intronic
900603065 1:3511411-3511433 TGGTCTGGCTGCCTGGGCCCTGG - Intronic
900945834 1:5830905-5830927 GCCTGTGCTTGCCTGGGCCCTGG + Intergenic
900952648 1:5866451-5866473 ACATCTGGTTGGCAGGGCCCCGG - Exonic
901234959 1:7662846-7662868 ACCTCTGGTTGCCAGGCCCCAGG + Intronic
901449751 1:9328868-9328890 GCGTCTGGTGGGTGGGGGCCAGG - Intronic
901929217 1:12586100-12586122 ACCTCTGGTCTCCGGGGCCCCGG + Intronic
903175449 1:21577653-21577675 GCTTGTGGGTGCCCGGGCCCTGG - Exonic
906125994 1:43427288-43427310 GCGTCTGGCTGCCTGTGGCCTGG + Exonic
907442129 1:54485532-54485554 GGGTCTTGTTGCTGGAGCCCTGG - Intergenic
909915457 1:81312480-81312502 CCTTCTGGGTGCCAGGGCCCAGG + Intronic
911060933 1:93747205-93747227 GCATCTGGTTGCCAGAGCCAAGG - Intronic
911664785 1:100539889-100539911 GCTTCTCGCTGCCGGTGCCCTGG + Exonic
914242047 1:145858876-145858898 GAGACTGGGTGCCGGGGCTCGGG - Intronic
915507923 1:156369098-156369120 GCTCCTGGTCCCCGGGGCCCTGG + Intergenic
915564271 1:156705220-156705242 GCGTCCGGGTCCCGGGGCTCTGG - Intronic
924844400 1:247750444-247750466 GCGTCTGGTTTCTGGGTCCATGG - Intergenic
1064028887 10:11870248-11870270 CCGTTGGGCTGCCGGGGCCCGGG - Exonic
1064245676 10:13666036-13666058 GCGTCTGGTTGCCGGGGCCCGGG + Intronic
1070290036 10:75108191-75108213 GCGGTTGTTTGCCGTGGCCCTGG + Intronic
1076374211 10:129972760-129972782 GGGCCGGGTTGCCGGGGCCCCGG - Intergenic
1076929428 10:133520303-133520325 CCCTCTGGTGGGCGGGGCCCGGG + Intergenic
1078514385 11:12009444-12009466 GCGTGAGGTGGCCGGCGCCCCGG - Intronic
1079158046 11:17967225-17967247 GACTCTGGTTGCCAGGCCCCTGG - Intronic
1083714114 11:64565886-64565908 GGGTCTGGTCGCGCGGGCCCTGG - Intronic
1084472037 11:69368185-69368207 GTGTGTGGTCACCGGGGCCCTGG - Intergenic
1084788504 11:71458320-71458342 GTGTCTGGGGGCCGGGGCTCAGG - Intronic
1089253021 11:117178923-117178945 GCGGCTGGTTGCCGGGAGCCTGG - Exonic
1089461728 11:118657945-118657967 GCCCTTGGTTGCCTGGGCCCAGG + Exonic
1089466097 11:118687694-118687716 GCCCTTGGTTGCCTGGGCCCAGG + Intergenic
1089515705 11:119030332-119030354 GGGGCATGTTGCCGGGGCCCTGG - Intronic
1090203601 11:124872915-124872937 GCGTCTGATTGGCTGGTCCCTGG - Exonic
1091216921 11:133907793-133907815 GCCTCTGGCTGCTGGGGCCTGGG - Intergenic
1091293241 11:134454222-134454244 GAGTTTGGTTGCCTGGGTCCAGG + Intergenic
1091750573 12:3019230-3019252 GCGTTCGGCTGCCGGGGGCCTGG - Intronic
1092508448 12:9127848-9127870 GCGACTGGGCCCCGGGGCCCCGG + Intergenic
1098161262 12:67649393-67649415 GCTTCTGCCTGCCGGGGGCCCGG + Intronic
1103930105 12:124445499-124445521 GCGTCTGCATGCTGGGGCCGCGG - Intronic
1105407170 13:20142405-20142427 GCGGCTGGTGGCGGGGCCCCGGG + Exonic
1106764817 13:32903214-32903236 GCTCCTGGTTGCAGGGGCCATGG + Intergenic
1110558503 13:76886219-76886241 GCGTCCGGGTTCCGGGGCTCCGG - Exonic
1111330731 13:86760215-86760237 GAGTTTGGTTGGCGGGGCCTTGG + Intergenic
1113854111 13:113434711-113434733 ACGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854484 13:113436139-113436161 GCGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854562 13:113436433-113436455 GCACCTGGGTGCCGGGTCCCGGG - Intronic
1113854588 13:113436517-113436539 GCGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854614 13:113436601-113436623 GCACCTGGGTGCCGGGTCCCGGG - Intronic
1113854653 13:113436727-113436749 GCACCTGGGTGCCGGGTCCCGGG - Intronic
1113854679 13:113436811-113436833 GCGCCTGGGTGCCGGGTCCCGGG - Intronic
1113854734 13:113437021-113437043 GCGCCTGGGTGCCGAGTCCCAGG - Intronic
1113854795 13:113437273-113437295 GCGCCTGGGTGCTGGGTCCCGGG - Intronic
1121567643 14:94922814-94922836 GTGGCTGGTGGCTGGGGCCCTGG - Intergenic
1122066171 14:99175671-99175693 GCATAGGGTTGCCGCGGCCCGGG + Exonic
1122941218 14:104982220-104982242 GAGGCTGGGTGCCGGGGCCTGGG + Intergenic
1123063779 14:105606185-105606207 GCTGCTGGCTGCCAGGGCCCTGG + Intergenic
1125171142 15:36768077-36768099 GCCTCTGGATGCAGGGGTCCTGG - Intronic
1125589244 15:40844312-40844334 CTGTCTGGCTGCCGGGTCCCTGG + Intronic
1128148633 15:65347144-65347166 GTGTCTGGTTAGGGGGGCCCAGG + Intronic
1131133140 15:89912764-89912786 GCGTCCGGCTGCCAGGGGCCTGG - Exonic
1131214964 15:90529457-90529479 GCGGCTGGAGGCCGGGGGCCTGG + Intergenic
1131257416 15:90871650-90871672 GCGTCTGGGAGCCGGGCCCGAGG + Intronic
1132372349 15:101307625-101307647 GGGGCTGGGTGCCAGGGCCCAGG - Intronic
1132408038 15:101556443-101556465 GGGTCTGGGTTCCGGGTCCCAGG + Intergenic
1132738378 16:1398644-1398666 GTGTCTGGATGCCTGGGCCATGG - Exonic
1134086373 16:11360155-11360177 GCCTCTGATTTCCTGGGCCCAGG + Intronic
1135407653 16:22209405-22209427 TCGTCTGGTTGCCGGGACTCTGG + Intronic
1135587788 16:23684046-23684068 GCTTCCGGTTGCTGGGGTCCAGG - Exonic
1137543218 16:49378606-49378628 GATTCTGGTGGCCGGGGCCAAGG - Intronic
1137712246 16:50574504-50574526 GCTGCTGGTGGCCGAGGCCCAGG + Intronic
1142191984 16:88722321-88722343 GCGTGTGGTAGCCGGTGCTCAGG + Exonic
1142373922 16:89697236-89697258 GCCTCTGGTTGCCTTGTCCCTGG - Exonic
1142766721 17:2068530-2068552 GCCTCTGGTTGCTGGGACACAGG + Intronic
1145272540 17:21412545-21412567 GCGTCTGAGTGCCCCGGCCCTGG + Intronic
1145310750 17:21700008-21700030 GCGTCTGAGTGCCCCGGCCCTGG + Intronic
1147742496 17:42676938-42676960 GCGTCCGGTGGCCGGGGCCCGGG + Exonic
1149992501 17:61390731-61390753 GCGTGTGGTGGCAGGGGGCCTGG + Intronic
1152352560 17:79791727-79791749 GCGTCTGGTCTCCGAGGCCCCGG - Intergenic
1160864012 19:1249342-1249364 GCGCCTCGTGGCCGGGGTCCCGG - Intronic
1160969176 19:1759867-1759889 GGGTCTGGTTCTCGTGGCCCTGG - Intronic
1161087571 19:2342223-2342245 GCGGCTGGCTGCAGGGGCCGTGG + Intronic
1161161068 19:2762143-2762165 GCCCCTGGTTGCCTGGTCCCTGG - Intronic
1161397273 19:4051526-4051548 GGGTCTGGTTGCCAAGGGCCAGG - Intronic
1161397798 19:4054038-4054060 GCGGCAGCTTGCCGGCGCCCTGG + Exonic
1161493632 19:4575937-4575959 GCGTCTGGACTCCTGGGCCCGGG - Intergenic
1161685493 19:5700735-5700757 GCATGTGGGTGCCCGGGCCCAGG - Intronic
1162751729 19:12833766-12833788 GCGTCTGGGCGCCCGAGCCCGGG - Intronic
1163612202 19:18307531-18307553 GTGTTTGGTGGCCGGGGCCGAGG - Exonic
1165553158 19:36605491-36605513 GCGTCTGGATACCGCGGTCCCGG - Intronic
1166214976 19:41328921-41328943 GGGTCTGGGTGCCAGGGACCTGG - Intronic
1167383338 19:49150710-49150732 GCGTCCGGTCGCCGGTCCCCCGG + Exonic
1167566496 19:50260903-50260925 GCGTTTGTGTGCAGGGGCCCAGG + Intronic
1168719035 19:58544803-58544825 GCCTCTGGCAGCCCGGGCCCGGG + Exonic
929770540 2:44888073-44888095 GCTTCTGGTTGCCTGTTCCCTGG - Intergenic
930872685 2:56184398-56184420 GCGGCTGGCTGCCGGGCCCTGGG + Exonic
932209269 2:69914396-69914418 CGGTCTGGTGGCCGCGGCCCTGG - Intronic
933723660 2:85413944-85413966 GGGTCCGGTCGCCGGGGACCTGG - Intronic
936029829 2:109062382-109062404 CGGTCTGGTTGAAGGGGCCCAGG - Intergenic
936632255 2:114216106-114216128 GGGTCTGGTTGCTGGGGCTGGGG - Intergenic
942051641 2:172146220-172146242 GCGCCTGGGTGCCATGGCCCAGG + Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
947575457 2:231270142-231270164 AGGTCTGGTTGCCAGGGTCCTGG + Intronic
948910185 2:240998861-240998883 GCTGCTGGTGGCCGCGGCCCTGG + Exonic
949001358 2:241616017-241616039 GCGTCTTGTGGCAGGGGCTCTGG - Intronic
1169143621 20:3239117-3239139 GCGCCTGGTGGCCGCGGCCATGG + Intronic
1169254305 20:4085518-4085540 CCGTCTGGTTCCCGGGCCCCAGG + Intergenic
1178351019 21:31873297-31873319 GCGCCTGGGTCCCGGGGTCCGGG - Exonic
1179475297 21:41639417-41639439 ACGTGTGGTTCCCGGGGGCCGGG + Intergenic
1180162862 21:46006031-46006053 GCGGGTGGTGGCCGGGGCCCGGG + Intergenic
1181024506 22:20120407-20120429 GCTCCTGGTGGCCTGGGCCCAGG + Intronic
1183293767 22:37018450-37018472 GCGTGTGGTTGCTGATGCCCAGG + Exonic
1183303710 22:37070886-37070908 CTGCCTGGCTGCCGGGGCCCTGG - Intronic
1183409536 22:37646826-37646848 CCGTCTGGCTGCTGGGGCCTCGG + Exonic
954200946 3:49022742-49022764 TCTTCTGGTTGCTGGAGCCCCGG + Exonic
954242144 3:49302278-49302300 GAGTGTTGTTGCCAGGGCCCTGG - Intronic
955971658 3:64443874-64443896 GCATCTGGCTGCTGGGGCTCTGG - Intronic
961221559 3:125205075-125205097 GCCTCTGGTTGCCGGGTGTCTGG - Intronic
961594680 3:128006904-128006926 GCCTCTGGGAGCCGGAGCCCTGG - Intergenic
964580889 3:158236472-158236494 GCTTCTGGATGCTGGGGGCCAGG - Intronic
968603249 4:1520309-1520331 GCTTGTGGGTGCCGGGGCCGTGG - Intergenic
968624914 4:1622700-1622722 GCGGCTGTTTGGCTGGGCCCAGG + Intronic
968920724 4:3521122-3521144 GGGTGTGGTTGCATGGGCCCCGG - Intronic
980075218 4:128287535-128287557 GGGTCTGGGGGCCGGGGCCGGGG - Exonic
984382703 4:179015653-179015675 GCTTCTGGTTGTCTGGGACCTGG + Intergenic
985784509 5:1886888-1886910 CCGTGTGGCTGCCGGGGCCGCGG + Exonic
985896160 5:2751113-2751135 CCGTCTGGGTCCCGGCGCCCAGG + Intronic
994171355 5:96662456-96662478 GCGGCTGCTCGCCGGGGCCGCGG - Exonic
996543263 5:124651760-124651782 GCGTCTGATTGGCTGGGCCGAGG + Intronic
997689261 5:135814638-135814660 GTGTCTGGGTGCCTGGTCCCAGG - Intergenic
1001898000 5:175397730-175397752 GCCTCTGGTTGCTGTGGCCAAGG - Intergenic
1002253009 5:177941095-177941117 GGGTCTGGGTGTCGGGGCCAGGG + Intergenic
1003404389 6:5816588-5816610 GCCTCAGGTGGCAGGGGCCCTGG + Intergenic
1005915212 6:30345318-30345340 GCGCCTGGTTCTCGGGGTCCTGG - Exonic
1006131309 6:31870977-31870999 GCGCCTGGTGGCTGGGCCCCTGG - Exonic
1007950857 6:45871131-45871153 GCGTCTGTTTACTAGGGCCCAGG + Intergenic
1015251847 6:131135597-131135619 GCGACAGGCTGCGGGGGCCCGGG - Intergenic
1017158228 6:151341553-151341575 GCGGCTGGCTTCCCGGGCCCAGG + Intronic
1017830101 6:158118986-158119008 GGCCCTGGTTGCTGGGGCCCTGG - Intronic
1019473517 7:1233325-1233347 GCGGCTGGGGGCGGGGGCCCTGG + Intronic
1022396266 7:29989910-29989932 GCGTCTGGCTGCACGGGCCGCGG + Intronic
1023969553 7:44980849-44980871 GCTGCTGGTTGCTGGGACCCTGG + Intergenic
1030528361 7:110680777-110680799 GCATCTGATTGGCTGGGCCCAGG - Intronic
1034255553 7:149722845-149722867 GTCTCGGGGTGCCGGGGCCCAGG - Exonic
1037986944 8:23296019-23296041 GCGGCTGGTGGCCCGGGCCCTGG + Exonic
1040371334 8:46778778-46778800 GCCTCCTGTTGCCAGGGCCCAGG - Intergenic
1040382000 8:46882111-46882133 GCATCCTGTTGCCAGGGCCCAGG + Intergenic
1040538676 8:48332006-48332028 GCTTCTGGCTGTCTGGGCCCTGG - Intergenic
1048921103 8:139230924-139230946 GCATCTGGTGGCCGGGGCAGTGG - Intergenic
1049700167 8:144007280-144007302 GCTCCTGGTTGGCAGGGCCCTGG + Intronic
1053015662 9:34660565-34660587 GGGACTGGTGGCTGGGGCCCTGG + Exonic
1055107365 9:72526991-72527013 GCGTCTGGTACCCAGGACCCTGG - Intronic
1056602310 9:88055668-88055690 GCCTCTGGTTGCTGGTGCCGTGG - Intergenic
1056835806 9:89954205-89954227 GCTTCTGGCTGCCAGGGCTCTGG + Intergenic
1060422617 9:123480203-123480225 GAGTCTGGAAGCAGGGGCCCTGG - Intronic
1062165456 9:135105267-135105289 GAGCCAGGTTGCCGGGGCCTTGG + Intronic
1062332306 9:136050074-136050096 GCAGCTGGTTGCAGGGGCTCTGG + Exonic
1062441271 9:136570824-136570846 GTGCCTGGCTGCCGGGGCCAGGG + Intergenic
1185781138 X:2847906-2847928 GCATCTGGTGGGCGGAGCCCAGG - Intronic
1190735048 X:53250579-53250601 GGGGCTGGTGGCAGGGGCCCTGG + Exonic
1192034115 X:67545255-67545277 GCCTCTGGGTGCCTGGGGCCCGG - Exonic
1200119320 X:153783054-153783076 GCGCCTGGCTGCCGAGGCCACGG + Exonic
1200849783 Y:7871151-7871173 GCTTCTTGTTGACAGGGCCCAGG + Intergenic