ID: 1064246823

View in Genome Browser
Species Human (GRCh38)
Location 10:13674877-13674899
Sequence CTAGCTCATCCCGTTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064246823_1064246826 -2 Left 1064246823 10:13674877-13674899 CCAATTTCAACGGGATGAGCTAG 0: 1
1: 0
2: 0
3: 5
4: 30
Right 1064246826 10:13674898-13674920 AGGAAAGGCTTACAGCTTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064246823 Original CRISPR CTAGCTCATCCCGTTGAAAT TGG (reversed) Intronic
910201027 1:84698850-84698872 CTAGCTAATCCCTTTGGATTTGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1095853943 12:46840444-46840466 CTAGCTCATACCTTTAAAAAGGG - Intergenic
1105986132 13:25569500-25569522 CTAGTGCATCCCTTTTAAATAGG - Intronic
1106968051 13:35097189-35097211 CTAGCTCTTCCAGTTTCAATAGG - Intronic
1111858498 13:93671112-93671134 CTAGCTCAGCCTGTTGTAATTGG + Intronic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1123484864 15:20682292-20682314 CTAGCTCTTCCAGTTTCAATAGG + Intergenic
1123537595 15:21251360-21251382 CTAGCTCTTCCAGTTTCAATAGG + Intergenic
1128927748 15:71674261-71674283 CCAGCTCTGCCCATTGAAATTGG + Intronic
1130405662 15:83598714-83598736 GTAGCTTATCTCCTTGAAATTGG - Intronic
1133179508 16:4042513-4042535 CTAGCTAATTCTGTTAAAATAGG + Intronic
1147370933 17:39992536-39992558 CTGGCTCATCCTGTTCAAAGCGG + Intronic
1156215098 18:34989929-34989951 CTAACTCACCCCATTGAGATGGG - Intronic
934842363 2:97635776-97635798 GGAGCTCATTCCGATGAAATAGG + Intergenic
946790306 2:223293964-223293986 CCAGCTCATCTCATTGAGATTGG - Intergenic
947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG + Intronic
948376932 2:237526954-237526976 CTAACTCATCCCATTGTCATAGG + Intronic
964203898 3:154148940-154148962 CTAGCCCAACCCTTAGAAATGGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
975542395 4:75528118-75528140 GTGGCTCTTCCAGTTGAAATAGG + Exonic
976308739 4:83588560-83588582 GTAGCTCATCCCTATGAGATAGG + Intronic
979748644 4:124248049-124248071 CTAGCTTATCCTGTTGACATGGG - Intergenic
986167314 5:5286114-5286136 CTAGTTCATCCCATTTAAATGGG - Intronic
986523458 5:8646166-8646188 TTAGTTCATTCAGTTGAAATAGG + Intergenic
989123229 5:38025722-38025744 CTAGCTCTTGCCGATGGAATGGG + Intergenic
993961954 5:94308867-94308889 ATAGATCATTCCATTGAAATTGG + Intronic
1001173221 5:169441428-169441450 CGAGCTCCTCTGGTTGAAATGGG + Intergenic
1011578098 6:88827189-88827211 CTGGCTCATCTCGTTGGGATTGG + Intronic
1013566996 6:111375500-111375522 CTACCTCATCCCATGGAAATTGG - Exonic
1017787184 6:157766206-157766228 CAAGTTCATCCCTTTGAAATGGG - Intronic
1018507049 6:164483067-164483089 CTAGGTCACACCGTTGCAATAGG + Intergenic
1019107637 6:169681976-169681998 CCAACTCCTCCTGTTGAAATCGG + Intronic
1020839480 7:13197545-13197567 CTAGCCCAACATGTTGAAATAGG + Intergenic
1047826092 8:128577385-128577407 CTACCTCATGCTGTTGTAATAGG - Intergenic
1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG + Intronic