ID: 1064246826

View in Genome Browser
Species Human (GRCh38)
Location 10:13674898-13674920
Sequence AGGAAAGGCTTACAGCTTCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064246823_1064246826 -2 Left 1064246823 10:13674877-13674899 CCAATTTCAACGGGATGAGCTAG 0: 1
1: 0
2: 0
3: 5
4: 30
Right 1064246826 10:13674898-13674920 AGGAAAGGCTTACAGCTTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064246826 Original CRISPR AGGAAAGGCTTACAGCTTCT CGG Exonic
906134970 1:43492355-43492377 ACCAAAGGCTTGCAGCTACTTGG - Intergenic
906789692 1:48647903-48647925 AGGAGTTGCTTGCAGCTTCTTGG + Intronic
907234174 1:53029769-53029791 AGGACAGGTCTGCAGCTTCTAGG - Intronic
907339880 1:53727314-53727336 AGGACAGGCTTAGAGCCCCTGGG - Intronic
909039059 1:70628568-70628590 AGCAAAGGCTTATTCCTTCTTGG - Intergenic
909903733 1:81170959-81170981 AGGAAAGGCTTTCAGTTTTTTGG + Intergenic
909953889 1:81753856-81753878 GGGAAAGACATTCAGCTTCTGGG - Intronic
910536036 1:88298745-88298767 AGTAAAGGGTTACACATTCTAGG - Intergenic
912021051 1:105109901-105109923 AGGAAAGCCATTCAGCTTCGGGG + Intergenic
914200540 1:145480768-145480790 AGGAATGGCTTTCAGATCCTAGG - Intergenic
914479654 1:148053895-148053917 AGGAATGGCTTTCAGATCCTAGG - Intergenic
914509043 1:148315033-148315055 AGGAATGGCTTTCAGATCCTGGG - Intergenic
916560938 1:165933733-165933755 AGGAAGGGCTCACAGCTTTCAGG - Intergenic
916797167 1:168178060-168178082 AGGAGAGGCTTACAGATCATAGG - Intergenic
918810457 1:189111885-189111907 AAGAAAGGCAAACATCTTCTAGG - Intergenic
919967159 1:202539285-202539307 AAGAAAGCCTGCCAGCTTCTAGG - Intronic
920312865 1:205058701-205058723 AGGAAGGGCTTCCAGATGCTTGG + Intronic
921222450 1:212982708-212982730 AGAAAAGGATTTCATCTTCTGGG + Intronic
921407229 1:214793779-214793801 AGGATATGCTTATGGCTTCTTGG + Intergenic
923231509 1:231990678-231990700 AGGCATGGCTTACATCTTTTGGG + Intronic
923550335 1:234958497-234958519 AAGAAATGGTTACAGCTGCTGGG + Intergenic
924000863 1:239550126-239550148 AGGTAAGGCTTGCTGCTGCTAGG - Intronic
924496407 1:244594655-244594677 AGTCAAGGCTTTCAGCTTTTGGG + Intronic
924578198 1:245299929-245299951 AGGAGAGGCTGAGAGCTTCCTGG + Intronic
1063697339 10:8349553-8349575 AAGAAAGGGTTATAGATTCTAGG + Intergenic
1063727543 10:8655128-8655150 AGGAAAGGCTTATACATTGTTGG + Intergenic
1063728047 10:8661476-8661498 AGGAAAGGCTTATACATTGTTGG + Intergenic
1064246826 10:13674898-13674920 AGGAAAGGCTTACAGCTTCTCGG + Exonic
1065199903 10:23302538-23302560 TGGAAAGGCTAACAGATGCTGGG - Intronic
1065701631 10:28431423-28431445 AGGAAATTCTCAAAGCTTCTAGG - Intergenic
1069509315 10:69029751-69029773 AGGAGAGGGTTGCAGCTCCTAGG - Intergenic
1069996218 10:72343624-72343646 GGGCAAGGCTGACAGCTCCTTGG + Intronic
1071529926 10:86381296-86381318 AGGAGATGCCTACAGCTTGTAGG - Intergenic
1072503992 10:96045634-96045656 AGGAAAGAGTTGCAGTTTCTTGG + Intronic
1073589241 10:104740604-104740626 AGGAAGGGATTCCAGCTTCAGGG + Intronic
1074887778 10:117708117-117708139 ACGAAAGGCTTTTGGCTTCTAGG - Intergenic
1077385372 11:2267227-2267249 AGGAAAGGCCCACAGCTGCCAGG - Intergenic
1077702501 11:4455153-4455175 AGGAAACACCTAAAGCTTCTAGG + Intergenic
1077704123 11:4467984-4468006 TGAAAATGCTCACAGCTTCTGGG + Intergenic
1078796198 11:14594017-14594039 AGGAAAGGTTTACCTCTTCATGG + Intronic
1081426783 11:42934222-42934244 TGGAAAGGCTTGCAGCTTTGTGG - Intergenic
1081428199 11:42948445-42948467 AGGAAAGGCTGCCAGGTCCTAGG - Intergenic
1081654417 11:44848164-44848186 AGGGAAGGCTGACAGGTTGTGGG + Intronic
1082236739 11:49826609-49826631 AGGAAAGGCCTACAGAAGCTGGG + Intergenic
1082594958 11:55066618-55066640 AGGAAAGATTTACAGCTGCGAGG + Intergenic
1085869300 11:80330445-80330467 AGGAAGGAGTTACAGCTTATGGG + Intergenic
1086211853 11:84330289-84330311 GGGCAAGGCTTTCTGCTTCTGGG + Intronic
1090710980 11:129384923-129384945 AGGAAAGTCATTTAGCTTCTAGG - Intronic
1094320258 12:29174905-29174927 AGGAAAGCCATTCAGCTTCGGGG - Intronic
1096034860 12:48457707-48457729 TGGAGAGGCTCACAGCTTCTGGG - Intergenic
1097764169 12:63504869-63504891 AGGAAAGGCTTCCAGATATTCGG - Intergenic
1099784459 12:87243125-87243147 TGGAAAGCCTTTCAGTTTCTGGG - Intergenic
1099898900 12:88682573-88682595 CAGAAAGGCTGACAGCTTCTGGG - Intergenic
1102828042 12:115967359-115967381 AGGAAATGCTGAAAGCCTCTTGG + Intronic
1103100676 12:118171993-118172015 AGGCAGGGAGTACAGCTTCTTGG + Intronic
1103226098 12:119289466-119289488 GGGAATGGCTTACAACTGCTAGG + Intergenic
1105762218 13:23525602-23525624 AGGAAAGCCTTGCAGCTCCGGGG + Intergenic
1107553291 13:41496437-41496459 AGGAAAAGCTTACAGGCTCCAGG - Intergenic
1108800885 13:54092963-54092985 AGGTAAGGCTTGCAGATTGTAGG + Intergenic
1109058501 13:57582422-57582444 GGGCAAGACTTACAGGTTCTTGG - Intergenic
1109129044 13:58557337-58557359 AGGTAAGGTTCACAGTTTCTGGG + Intergenic
1109210727 13:59532671-59532693 ATGAAAGGCTTACAATTTTTAGG + Intergenic
1111669137 13:91306013-91306035 AGGAAAGGACTCCAGATTCTAGG - Intergenic
1112243559 13:97706254-97706276 TAAAAAGGGTTACAGCTTCTAGG - Intergenic
1112679598 13:101747993-101748015 AGAAAAGGCTTACACATTGTTGG + Intronic
1112838864 13:103550500-103550522 AGGAAAGACGTAAACCTTCTTGG - Intergenic
1113031535 13:105998457-105998479 ATGAAAAGCTTAAAACTTCTGGG - Intergenic
1113159980 13:107368780-107368802 AGGCAACGCTAACAGGTTCTTGG + Intronic
1118038128 14:61890190-61890212 AAGAAAGGCTGGGAGCTTCTGGG + Intergenic
1120023218 14:79553390-79553412 CCCAAAGGCTTACAGCTGCTAGG + Intronic
1121172607 14:91867651-91867673 AGGGAGGACTTGCAGCTTCTTGG + Intergenic
1121476416 14:94210994-94211016 ATGAAATGCTGACAGCATCTCGG + Intronic
1122245142 14:100397216-100397238 TGGAAAGCTTTTCAGCTTCTCGG + Intronic
1122311878 14:100802597-100802619 AGGAAAGGGGGCCAGCTTCTGGG + Intergenic
1122757177 14:103990687-103990709 AGGAAGGGCTCACAGGTTCATGG + Intronic
1202866049 14_GL000225v1_random:118260-118282 AGGAAAGACTTACATCACCTGGG - Intergenic
1123807777 15:23892688-23892710 AGGCAATGCATACAGCTTTTGGG - Intergenic
1126056497 15:44734722-44734744 AGACAAGGCTTCCATCTTCTAGG + Intronic
1126337268 15:47599949-47599971 AGGAAAAGCTTCCAGTTCCTAGG + Intronic
1127483565 15:59399271-59399293 TGGAAATGTTTCCAGCTTCTGGG - Intronic
1129378676 15:75151927-75151949 AGTAAAGGCTTACAGTTTAGAGG - Intergenic
1130804011 15:87299558-87299580 AGGAAAAGCTTCAAGCTGCTAGG - Intergenic
1133872678 16:9703989-9704011 AGCAGAGGCTTACAGGTTATAGG - Intergenic
1137367642 16:47874450-47874472 AGGAAGGGCTTACAGGTGCCTGG - Intergenic
1139264234 16:65624090-65624112 AGGCAAAGCTTGCACCTTCTGGG + Intergenic
1140779680 16:78283125-78283147 AGCTAATTCTTACAGCTTCTGGG + Intronic
1141849818 16:86637484-86637506 AGGGAACACGTACAGCTTCTGGG + Intergenic
1142663435 17:1447384-1447406 AGGATATCCTTTCAGCTTCTCGG + Intronic
1143091988 17:4454293-4454315 GGGAAAGGGCTACTGCTTCTGGG + Intronic
1144171706 17:12665244-12665266 TGGAAAGGCTTTCATTTTCTAGG - Intergenic
1146186440 17:30727497-30727519 AGTCAAGGCTTTCAGCTCCTGGG + Intergenic
1146473566 17:33144004-33144026 AGGAAAGGCTTCCATTTTCTGGG + Intronic
1146575851 17:33990668-33990690 CTGAAAGGCTCACAGTTTCTTGG + Intronic
1146584025 17:34066541-34066563 GTGAAAGGCTTTCAGCTGCTGGG - Intronic
1146691736 17:34881483-34881505 AGGTGAGGCTTCCAGGTTCTAGG - Intergenic
1149016272 17:51912288-51912310 TGGTAAGGATTACAGCTTATTGG - Intronic
1149564154 17:57629723-57629745 AGGAAAAGCCACCAGCTTCTGGG - Intronic
1152225503 17:79090903-79090925 AGGCAGGACTTGCAGCTTCTCGG + Intronic
1158292038 18:55953852-55953874 CTGAAAGGCAAACAGCTTCTGGG - Intergenic
1158492027 18:57918719-57918741 AGGTAACACTCACAGCTTCTGGG + Intergenic
1159250421 18:65868511-65868533 AGGAAATGCTTACAGGTTTGTGG + Intronic
1163111228 19:15161762-15161784 AGCAAAGTCTTCCAGCCTCTTGG + Intronic
1164943705 19:32271998-32272020 AGGAAGGTCTTACTGCTGCTAGG - Intergenic
1165215950 19:34272669-34272691 GGTTAAGGCTTCCAGCTTCTTGG - Intronic
1165711736 19:38016149-38016171 GGGAAGGGCTCACAGCTTCTGGG + Intronic
1165957476 19:39510413-39510435 GGGAAAGGCATTCAGCTTGTAGG - Intergenic
1166421199 19:42638569-42638591 AGGAAAGTTTTACAACTTTTTGG - Intronic
926582263 2:14643545-14643567 AGCAAAGGCATACAACTACTAGG - Intronic
927119605 2:19944638-19944660 AGGAAAGGCATTCAGATTCAGGG - Intronic
929759198 2:44792059-44792081 AGGAATTGTTTACAGATTCTCGG - Intergenic
936533498 2:113292880-113292902 ATGAAAGACTTCCATCTTCTAGG - Intergenic
937123918 2:119461005-119461027 TGGAATGGCCAACAGCTTCTGGG - Intronic
938371318 2:130770127-130770149 AGGGAGGGCTTACAGGTTATAGG + Intergenic
939042227 2:137204016-137204038 AGGAATAGTTTACAGCTGCTAGG + Intronic
940190356 2:151034460-151034482 AGGAAATAATTTCAGCTTCTAGG - Intronic
943133504 2:183886286-183886308 AGGAAAGGCATTCAGCTCCGGGG + Intergenic
943319636 2:186431926-186431948 AGCAAAAGCTCACTGCTTCTTGG - Intergenic
944090692 2:195907268-195907290 AGGAAAGGCTTTGAGATTATAGG - Intronic
945606948 2:211945556-211945578 AAGAAAATCTCACAGCTTCTAGG + Intronic
945749069 2:213757603-213757625 ACTAAAGGCTTGCAACTTCTAGG + Intronic
946645913 2:221833903-221833925 AGGAATTGCCTACAGCTTCTGGG - Intergenic
1169519119 20:6352044-6352066 AGTAAAGGCCTACTGCTTATGGG + Intergenic
1170431601 20:16281722-16281744 AGGCCTGGCTTACTGCTTCTTGG - Intronic
1170943763 20:20871313-20871335 AAGAAAACGTTACAGCTTCTTGG + Intergenic
1175235179 20:57504848-57504870 AGCAAGGGCTTACAGGTTGTAGG - Intronic
1178329528 21:31675740-31675762 AGGAAATATTTACAGATTCTTGG - Intronic
1179474636 21:41635326-41635348 ATCAAAGGCTTTGAGCTTCTGGG + Intergenic
1182133829 22:27881660-27881682 AAGAAGGGCTTTCTGCTTCTTGG - Intronic
949337289 3:2989351-2989373 AGGAAAGGCTTCCTGTTTCCTGG - Intronic
950329777 3:12147051-12147073 AAGAAGGGCTTACTGCATCTTGG - Intronic
950715523 3:14845082-14845104 AGAAAATGCCTACAGCTTCTGGG + Intronic
950832426 3:15887951-15887973 TGGAATGACTTACAACTTCTGGG + Intergenic
951180128 3:19650057-19650079 AGGGAATGCTTCCAGCTTCAAGG + Intergenic
953978314 3:47399322-47399344 ATTAAAGGCTTGCAACTTCTAGG - Intronic
954446716 3:50550749-50550771 AGGCAAGGCTTTCATCTGCTGGG - Intergenic
956051410 3:65252195-65252217 AAGTAATGTTTACAGCTTCTAGG + Intergenic
956098613 3:65744090-65744112 AGGAAAGGCCAAAAGCTTCATGG + Intronic
959791713 3:110369296-110369318 AAGAAAGGATGACAGCTTCATGG - Intergenic
961128506 3:124443710-124443732 GGGAAATGCCTACATCTTCTTGG + Intronic
962263059 3:133927226-133927248 TGGGGAGGCTGACAGCTTCTGGG + Intergenic
963230582 3:142905306-142905328 AGGAAAGGCATACAGGTGGTCGG - Intergenic
966529129 3:180954726-180954748 GGGAAATACTTTCAGCTTCTTGG + Intronic
970266706 4:14296324-14296346 CAGAAAGGCTTACTGCCTCTGGG + Intergenic
972512297 4:39780027-39780049 AGGAAAGCCTTACAAATTTTTGG - Exonic
973160290 4:47007785-47007807 AAGTAAGGCTTACATCTCCTTGG - Intronic
973264142 4:48194185-48194207 TCGAAAGGCTCACAGCCTCTTGG + Intronic
974197426 4:58593685-58593707 AGGAAACTCATACAGTTTCTTGG - Intergenic
979511498 4:121559160-121559182 GGGTAAGGGTTACATCTTCTGGG - Intergenic
980218485 4:129882097-129882119 AGGGAAGTTTTACACCTTCTAGG - Intergenic
980239444 4:130154333-130154355 AGGTAAGGCATACAGCTTCAGGG - Intergenic
980803129 4:137779036-137779058 AGGAAAGGCTAACGTCTTGTAGG - Intergenic
983001757 4:162423304-162423326 AGGAAATGCTTACACATTGTTGG - Intergenic
983563583 4:169126303-169126325 AGGAAAGGATTCTAGCATCTCGG - Intronic
984769222 4:183422972-183422994 AGGAAAGGAATACAGAATCTCGG - Intergenic
985554562 5:551558-551580 ATGAAAATCTTCCAGCTTCTGGG - Intergenic
985743272 5:1632790-1632812 AGGGCAGGCTCACGGCTTCTTGG + Intergenic
989504964 5:42216458-42216480 AGCAAAGTTTCACAGCTTCTTGG - Intergenic
990190024 5:53249361-53249383 TGGAAAGGTTTAAAGATTCTTGG - Intergenic
990737410 5:58879235-58879257 AGGAAATGTTTACTGCCTCTAGG - Intergenic
996436725 5:123441679-123441701 AGCACAGGCATACAGCTCCTAGG - Intergenic
997226809 5:132215116-132215138 AAGGCAGGGTTACAGCTTCTTGG - Intronic
997519127 5:134511406-134511428 AGGAAAGGCAAGCAGCTCCTAGG - Intergenic
997720863 5:136077529-136077551 AGGAAATGCTCAAAGCTCCTGGG - Intergenic
998805388 5:145913312-145913334 AGGAAAGGCCTGCATCATCTAGG + Intergenic
998914798 5:147001920-147001942 AGGAAAGCCATTCAGCTTCAGGG + Intronic
998926368 5:147130569-147130591 AGGCATGGGTTACAGCTGCTGGG - Intergenic
1001176608 5:169474864-169474886 AGATAAGGCTTAAAGCTTCCAGG - Intergenic
1001441673 5:171748554-171748576 AGGAAGGGCATTCAGCTGCTGGG + Intergenic
1004439934 6:15640778-15640800 ATTAAAGGCTTGCAGCTTCCAGG + Intronic
1004467183 6:15897113-15897135 AGGAAAGTTTTAGAACTTCTGGG + Intergenic
1004546484 6:16603279-16603301 GGGAAAGGCTTAAAGCCTCTTGG - Intronic
1006003525 6:30985196-30985218 AGGGAAGGCTTTTAACTTCTTGG - Intronic
1007824625 6:44590761-44590783 TGGAAAGGCTTAGAGATTCCAGG - Intergenic
1012338649 6:98091222-98091244 AGGAGATGGGTACAGCTTCTAGG + Intergenic
1012573657 6:100763494-100763516 GGGAAAGGCTCAAAACTTCTTGG + Intronic
1018105584 6:160483269-160483291 AGCCAAGGCCTTCAGCTTCTGGG + Intergenic
1018107303 6:160501382-160501404 AGCCAAGGCCTTCAGCTTCTTGG + Intergenic
1018117867 6:160605679-160605701 AGGCAAGGTCTTCAGCTTCTGGG + Intronic
1020018426 7:4845945-4845967 ACGAAGGGCTCACAGCTTCCCGG - Intronic
1020719775 7:11727273-11727295 AGGAAAGGCATAGAGATGCTGGG - Intronic
1023364520 7:39450515-39450537 GGGAAATGCTTGCAGGTTCTAGG - Intronic
1026896135 7:74011039-74011061 GGGAAAGGCTGGCAGCTGCTTGG - Intergenic
1027755063 7:82202554-82202576 AGCAAAGGCTTATTCCTTCTTGG - Intronic
1029836035 7:103311159-103311181 CAGAAAGGCTCGCAGCTTCTTGG + Intronic
1029983125 7:104897549-104897571 ACGAAAGCCTCACAGCTTCCTGG + Intronic
1031247309 7:119331091-119331113 AGGGAAGGCTTACATATTGTTGG - Intergenic
1032713853 7:134487351-134487373 AGGAAAGCCATTCAGCTTCAGGG - Intergenic
1034681960 7:152935652-152935674 AGGAAGGACTCACATCTTCTTGG + Intergenic
1036090065 8:5656097-5656119 TAGAAAGGCTTACAGTGTCTAGG - Intergenic
1037381463 8:18289280-18289302 TGGAAAGGGTTACAGCTTCTAGG - Intergenic
1037528167 8:19748133-19748155 AGGAAAGAAATACATCTTCTTGG - Intronic
1038779571 8:30558383-30558405 AAAAAAGGGTTCCAGCTTCTTGG - Intronic
1039759775 8:40562164-40562186 AGGAATGTCCTACAGGTTCTTGG - Intronic
1045049645 8:98311169-98311191 CAGAATGGCTTCCAGCTTCTTGG + Intergenic
1047232025 8:123005631-123005653 AGGAAAGTCTTTCAAATTCTGGG + Intergenic
1047400021 8:124538643-124538665 CGGAGAGGCTGACCGCTTCTGGG - Intronic
1048189046 8:132271743-132271765 AGGAAAGGCAATCAGCTTCCCGG - Intronic
1048854366 8:138673844-138673866 AGGGAAGGCTGAGAGTTTCTGGG + Intronic
1049650359 8:143764178-143764200 AGGAAAGGTGGACAGCTGCTTGG + Intergenic
1050312892 9:4371405-4371427 AGGAAAGGCTTAGCACTTATGGG - Intergenic
1051637198 9:19191249-19191271 AGAAAGGGGTTACAGCTTTTAGG - Intergenic
1052597601 9:30580385-30580407 GCGAAAGGATTACTGCTTCTTGG + Intergenic
1053130237 9:35610404-35610426 AGGTAAGGCCTACAACTTATGGG - Intronic
1055381637 9:75713664-75713686 AGGAAAAGTTTAATGCTTCTGGG - Intergenic
1056536460 9:87531927-87531949 AGGAAATGCTTAATGCTTATGGG + Intronic
1058676519 9:107404887-107404909 TGGAAAGCCCTGCAGCTTCTTGG + Intergenic
1058909446 9:109507387-109507409 AGGACAGGTTTCCAGTTTCTCGG - Intergenic
1059126325 9:111689828-111689850 AGAAAAAGCTTAAAGCTTTTAGG - Intronic
1059768405 9:117405149-117405171 AAGAAACGCCTGCAGCTTCTTGG + Intronic
1061676456 9:132218869-132218891 GGGAAGGGCTTACAGCTTCCAGG - Intronic
1061900892 9:133671437-133671459 AGGGAAGGTAAACAGCTTCTCGG + Intronic
1186980172 X:14950207-14950229 AAGAAAGGCTTGGGGCTTCTGGG - Intergenic
1187071725 X:15894970-15894992 AGGAAATACTTGCAGCTTCAAGG - Intergenic
1187244686 X:17543419-17543441 AGGAAATGCTTAGAGCTTGAAGG + Intronic
1188462471 X:30444731-30444753 AGGGAAGGCATGCAGCTTTTTGG + Intergenic
1188749713 X:33889960-33889982 AGGAAGGTCTTACTTCTTCTAGG - Intergenic
1189222574 X:39384892-39384914 AGGAAAGACTTACAGGGTCTTGG - Intergenic
1191089437 X:56604022-56604044 AGCAGAGGCTTACAGGTTATAGG + Intergenic
1192284306 X:69718045-69718067 AGGAAACGTTGACGGCTTCTGGG - Intronic
1192439686 X:71165445-71165467 AGGAAAGGCTTTCTTCTCCTAGG - Intronic
1196365440 X:114918343-114918365 AGGAAACTATTACAACTTCTGGG - Intergenic
1197176674 X:123493511-123493533 TGCAAAGGCTCACAGCTTTTGGG - Intergenic
1198429241 X:136549012-136549034 AGGAAATGCCTACAGATACTTGG + Intronic
1198708142 X:139471949-139471971 AGCCAAGGCTTCCAGCTTCCTGG + Intergenic
1199763545 X:150924254-150924276 AGGTAACACTTACAGGTTCTGGG + Intergenic
1199871080 X:151899511-151899533 AGGTAAGGACTACATCTTCTAGG + Intergenic
1200801266 Y:7389016-7389038 AGGAAAGCCATTCAGCTCCTGGG - Intergenic
1200890229 Y:8315442-8315464 AGGAGAGGGTTACAGCATCATGG - Intergenic
1202302760 Y:23435048-23435070 AAGAAAGCCTGCCAGCTTCTAGG - Intergenic
1202568051 Y:26235546-26235568 AAGAAAGCCTGCCAGCTTCTAGG + Intergenic