ID: 1064247174

View in Genome Browser
Species Human (GRCh38)
Location 10:13678235-13678257
Sequence CTGTATCCGCTAATGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064247169_1064247174 9 Left 1064247169 10:13678203-13678225 CCTGGCAGACTAGATGGCTCAAG 0: 1
1: 0
2: 1
3: 2
4: 129
Right 1064247174 10:13678235-13678257 CTGTATCCGCTAATGCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064247174 Original CRISPR CTGTATCCGCTAATGCTGGT TGG Intronic
No off target data available for this crispr