ID: 1064247341

View in Genome Browser
Species Human (GRCh38)
Location 10:13679581-13679603
Sequence GTGGGGTCAAGGAGGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064247328_1064247341 20 Left 1064247328 10:13679538-13679560 CCCTGGGTTAGCAGCTAGGTCTT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG No data
1064247329_1064247341 19 Left 1064247329 10:13679539-13679561 CCTGGGTTAGCAGCTAGGTCTTT 0: 1
1: 0
2: 0
3: 16
4: 728
Right 1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG No data
1064247326_1064247341 27 Left 1064247326 10:13679531-13679553 CCTGAGTCCCTGGGTTAGCAGCT 0: 1
1: 0
2: 2
3: 22
4: 250
Right 1064247341 10:13679581-13679603 GTGGGGTCAAGGAGGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064247341 Original CRISPR GTGGGGTCAAGGAGGTTCTG TGG Intronic
No off target data available for this crispr