ID: 1064247541

View in Genome Browser
Species Human (GRCh38)
Location 10:13680969-13680991
Sequence CAAGGCGTTACACCATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064247541_1064247542 -6 Left 1064247541 10:13680969-13680991 CCATTAAATGGTGTAACGCCTTG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1064247542 10:13680986-13681008 GCCTTGAGTTACTAATCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064247541 Original CRISPR CAAGGCGTTACACCATTTAA TGG (reversed) Intronic
906774867 1:48520075-48520097 CAAGGCGGAAAACCACTTAAAGG - Intergenic
907290880 1:53412204-53412226 CAATGAGTTATACCATTTAAAGG + Intergenic
921138541 1:212284844-212284866 CCAGGTGTTACACCACTGAAAGG - Intergenic
923270429 1:232350505-232350527 CAAGGCCTGAGACCATGTAATGG + Intergenic
923290859 1:232544225-232544247 CAATGTTTTACACGATTTAATGG + Intronic
1064247541 10:13680969-13680991 CAAGGCGTTACACCATTTAATGG - Intronic
1070041418 10:72784073-72784095 CAAGGAGCTACACCATCCAACGG - Intronic
1074652942 10:115545479-115545501 CAAGGAGTTATACACTTTAAGGG - Intronic
1076301301 10:129428790-129428812 CAAGGCGCTACACAATTTCCTGG - Intergenic
1086602133 11:88646431-88646453 CAAGTAGTTAAAACATTTAAGGG + Intronic
1095287369 12:40430223-40430245 GACGGGGTTTCACCATTTAAAGG + Intronic
1109342795 13:61083141-61083163 AAAGGAGTTGCACAATTTAAAGG - Intergenic
1114709752 14:24766377-24766399 CAAGGGGTTTCAGAATTTAAAGG + Intergenic
1124818733 15:33021656-33021678 CAAGGCCTGAGACCATTTGATGG + Intronic
1133873403 16:9710707-9710729 CAAGGGGTTACAGAATTTCATGG + Intergenic
1137063489 16:35812913-35812935 CAAGGCTGTTCACCATTTGAAGG - Intergenic
1150596651 17:66611753-66611775 GAAGTGGTTACACCATTTTATGG + Intronic
1155109103 18:22696656-22696678 AAAGGCTTTATACCAGTTAAAGG + Intergenic
1156623984 18:38886476-38886498 CAAGGCGTAAGACCTTTTACTGG - Intergenic
1159466942 18:68795904-68795926 GAAGGTGTTCCACCATTGAAAGG + Intronic
930858873 2:56049139-56049161 CAGGGCGCTGCAGCATTTAAAGG - Intergenic
936992992 2:118385948-118385970 CAACACGTTATACCTTTTAATGG - Intergenic
939748468 2:146008996-146009018 CAATGCTTAACAGCATTTAATGG - Intergenic
946206961 2:218116653-218116675 CAGGGCGGAAAACCATTTAAAGG + Intergenic
946972668 2:225112512-225112534 CAAGGCATTATACTATTGAATGG + Intergenic
957483149 3:80824848-80824870 CAAGGGATTACAGCATTTCAAGG - Intergenic
959574273 3:107917651-107917673 CAGGGCGGAAAACCATTTAAAGG - Intergenic
960217054 3:115053202-115053224 CAATGTGTTACATCTTTTAAAGG - Intronic
966090953 3:176135472-176135494 TAAGGCGTTTCACCCTTTACTGG + Intergenic
966108624 3:176368445-176368467 CAAGGCGTGAAAACATATAAGGG - Intergenic
971847501 4:31939378-31939400 CAAAGCCTAACATCATTTAAAGG - Intergenic
976592221 4:86860463-86860485 CAAGGCGATGCAACTTTTAAGGG - Intergenic
992915498 5:81448121-81448143 AAATACGTTACACCATTTAGAGG - Intronic
998546854 5:143036217-143036239 CAAGGCATTCTACCACTTAATGG - Intronic
1005413868 6:25581044-25581066 CAAGACCTTAGACCATTTTAGGG + Intronic
1008039511 6:46781843-46781865 CAAGGTGTAACATCATTTGACGG + Intergenic
1008295840 6:49775744-49775766 CAAGCAGATACACCACTTAATGG - Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1013226168 6:108120552-108120574 CAGCGTGTTACACCAATTAAAGG + Intronic
1019747143 7:2707333-2707355 CAAGGAGTTCTACCATTAAAAGG - Intronic
1037063552 8:14546743-14546765 CACGGAGTTATACCATGTAAAGG + Intronic
1037702549 8:21288050-21288072 CAAGGAGTTTCACCATTACAAGG - Intergenic
1043592551 8:81847340-81847362 CAAGGTGTTACAAGTTTTAAGGG - Intergenic
1186660255 X:11662246-11662268 CAGGGCGTTAAACCTTTGAAAGG + Intronic