ID: 1064247767

View in Genome Browser
Species Human (GRCh38)
Location 10:13682943-13682965
Sequence CTTTCTACACAGGTTTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064247767_1064247771 1 Left 1064247767 10:13682943-13682965 CCCTGGTAAACCTGTGTAGAAAG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1064247771 10:13682967-13682989 AGTCACATCGACTCCCAAGTGGG No data
1064247767_1064247770 0 Left 1064247767 10:13682943-13682965 CCCTGGTAAACCTGTGTAGAAAG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1064247770 10:13682966-13682988 CAGTCACATCGACTCCCAAGTGG No data
1064247767_1064247773 3 Left 1064247767 10:13682943-13682965 CCCTGGTAAACCTGTGTAGAAAG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1064247773 10:13682969-13682991 TCACATCGACTCCCAAGTGGGGG No data
1064247767_1064247772 2 Left 1064247767 10:13682943-13682965 CCCTGGTAAACCTGTGTAGAAAG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1064247772 10:13682968-13682990 GTCACATCGACTCCCAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064247767 Original CRISPR CTTTCTACACAGGTTTACCA GGG (reversed) Intronic
910170776 1:84374501-84374523 TTTTCTAGAAAGGCTTACCATGG - Intronic
911199438 1:95029819-95029841 CATTCTACACTGGTATACCATGG - Intronic
912976079 1:114331438-114331460 ATTTCTACACAAGTTTTGCAAGG + Intergenic
919060746 1:192629292-192629314 CCTTCTAAACATGTGTACCATGG + Intergenic
919327661 1:196129422-196129444 CTTTCTACAAAGTTTTAAAAGGG - Intergenic
919766293 1:201129335-201129357 CTTCCTACTCAGTGTTACCAGGG - Intergenic
924094294 1:240535472-240535494 CTTTAAACATTGGTTTACCAAGG - Intronic
924591071 1:245405067-245405089 TTTTCTAAACTGGTTTACCCAGG - Intronic
1063020484 10:2122196-2122218 CTTTCTCCTCAGGCTTAGCAGGG - Intergenic
1064247767 10:13682943-13682965 CTTTCTACACAGGTTTACCAGGG - Intronic
1068311409 10:55281315-55281337 ATTTCACCACAGGTTTTCCAGGG + Intronic
1073277647 10:102326348-102326370 TTTTCTACAAAGGTTGCCCAAGG + Intronic
1073399166 10:103242800-103242822 CTTACAACACTGGTTAACCAAGG + Intergenic
1073675035 10:105636650-105636672 ATTTATGCAAAGGTTTACCATGG - Intergenic
1075400194 10:122155579-122155601 CTTTCTTCCCAGGTTTAGAATGG + Intronic
1075568082 10:123519106-123519128 CTTTGACCACAGGTTTCCCAAGG + Intergenic
1078137554 11:8664325-8664347 CTTTCTTCAAAGATTTTCCATGG + Intronic
1079116061 11:17641214-17641236 CTTTCTACAGAGGTTTCTGAGGG - Intronic
1079891766 11:26064519-26064541 CTATCAACACAATTTTACCAGGG + Intergenic
1080198860 11:29645038-29645060 CTTTCTAAACAATTTGACCAAGG + Intergenic
1081030868 11:38081226-38081248 CTATATACACAGGTTTTCAAGGG + Intergenic
1081961015 11:47137448-47137470 ATTTCTACAAAGCTTTTCCAGGG - Intronic
1084703415 11:70802137-70802159 CTTTCTAGCCAGGTTTCCCAGGG - Intronic
1088899453 11:114104172-114104194 TTTTCTACACACGTTCACCCTGG - Intronic
1090066344 11:123506979-123507001 CCTTCTGCACATGTTCACCAGGG + Intergenic
1090307562 11:125704347-125704369 GTTTCCACACAGGTTCTCCAAGG + Intergenic
1090704288 11:129322514-129322536 CTTTCTAGACAGGTTAACTTTGG + Intergenic
1092003557 12:5050363-5050385 CTTTCTTCCCAGGTCTACCGTGG - Intergenic
1092988670 12:13873691-13873713 CTTTCTCCACTGGTTTCACAGGG - Intronic
1100151213 12:91740156-91740178 CTTTCTACTCTGTTTTACTAGGG + Intergenic
1100790680 12:98126711-98126733 CTTTTTACCCAGGTAGACCACGG + Intergenic
1102683585 12:114706934-114706956 CATTCTGCAAATGTTTACCAAGG + Intergenic
1102753692 12:115319493-115319515 GTTTCTAAATAGGATTACCATGG - Intergenic
1105357112 13:19668885-19668907 CTTTCCACTCAGCTTTACTATGG - Intronic
1106268730 13:28133916-28133938 CTTTCTATACAAGTTTTCAAAGG - Intergenic
1106616923 13:31339031-31339053 GTTTCCACACAGGTTCTCCAAGG + Intergenic
1108228237 13:48312546-48312568 CTTTCTTTACAGGTTTACCTTGG + Intronic
1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG + Intergenic
1109595386 13:64546594-64546616 ATTTCAACACAGTTTTGCCATGG + Intergenic
1115025911 14:28746044-28746066 CTTTCTTCATAAGTGTACCAAGG + Intergenic
1119319853 14:73723955-73723977 CTTCCTCCTCAGGTTTTCCAGGG - Intronic
1121192679 14:92044039-92044061 CTTTCTAGACAGGTCCAGCAAGG - Exonic
1122392293 14:101398200-101398222 CTTTCTGCAGAGGTTGACGACGG + Intergenic
1122493328 14:102135009-102135031 GTTTCCACACAGGTTCTCCAAGG + Intronic
1126559071 15:50023706-50023728 CTTTCCACACTAGGTTACCAGGG - Intronic
1132819245 16:1854701-1854723 CCTTCTCCACAGGGCTACCATGG + Intronic
1134621921 16:15695898-15695920 CATTCTGCAGAGGTTTAACAAGG + Intronic
1135777563 16:25270052-25270074 CTATCTACACTAGTTTACCATGG + Intergenic
1140299330 16:73740768-73740790 CTTTCTTCACACATTTACCATGG - Intergenic
1145838625 17:27974835-27974857 CTTTCCTTACAAGTTTACCAGGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1153213958 18:2799935-2799957 CTTTCTACACATTTTTTCTAAGG - Intronic
1156895020 18:42236035-42236057 CTTTATAGACATGTTTACCATGG + Intergenic
1156991141 18:43409070-43409092 CTTTCCAAATAGTTTTACCAAGG - Intergenic
1159044372 18:63354742-63354764 ATTTTTAATCAGGTTTACCAAGG - Intronic
1159777989 18:72625932-72625954 CTTTCTGCACAACTTTGCCAAGG - Intronic
1161426952 19:4208897-4208919 CTTTCCAAACAGGTTTTCCCAGG - Intronic
1162919785 19:13893948-13893970 CTTTCAAAGCAGGTTTTCCAGGG - Intronic
1164494031 19:28741739-28741761 CTTTCTACACTGTTTCACTAAGG - Intergenic
1165099273 19:33428808-33428830 CTTTCTTCACATGTTTACTGAGG - Intronic
927722056 2:25389472-25389494 CTTTCTCCACAACTATACCAGGG - Intronic
931381148 2:61754701-61754723 CATTCTAAACAGCTTTATCAAGG + Intergenic
937729881 2:125216009-125216031 CTCACTAAATAGGTTTACCATGG - Intergenic
938619032 2:133030405-133030427 CTTTCGACACAGGCTCACCATGG - Intronic
938728582 2:134128425-134128447 CTTAATACACAGTATTACCAAGG - Intronic
940860438 2:158765282-158765304 CCTCCTCCACGGGTTTACCATGG + Intergenic
945408049 2:209474118-209474140 CTCTCTATAGTGGTTTACCAAGG + Intronic
945858876 2:215098095-215098117 CTCTCTACACAGCTCTAACATGG - Intronic
946553218 2:220825082-220825104 CTTTCTACTCTGGTCTACAAAGG + Intergenic
1175301225 20:57943968-57943990 CTGTCTGAACAGGGTTACCAAGG - Intergenic
1178832269 21:36065972-36065994 CTTTCTACAGCGGTAGACCATGG - Intronic
1179237138 21:39557747-39557769 CTTTCTAAACTTGTTTACTATGG + Intronic
1179943350 21:44654083-44654105 CTTTCTACACAGTTTCTCCTGGG - Intronic
1183658792 22:39206547-39206569 CTGTCTACACAGCCTTCCCAGGG - Intergenic
1183827033 22:40396655-40396677 TTTTCTACAGACATTTACCATGG - Intronic
949576824 3:5346217-5346239 TTTGTTACACAGGTGTACCATGG - Intergenic
950128447 3:10525749-10525771 CTTTTTACACGGGTTTACACTGG - Intronic
951501536 3:23393014-23393036 CTTCCTTCACAGGCTTCCCAAGG - Intronic
952027821 3:29104700-29104722 CTTTCTCCACACATTTACTAAGG + Intergenic
953216769 3:40925567-40925589 ATTTCTAAACATGTTTTCCAGGG + Intergenic
953993494 3:47501887-47501909 CTCTCTACAGATGTTTATCAAGG + Intronic
954849184 3:53585911-53585933 CTTTCAACACTGGCATACCACGG + Intronic
956431794 3:69193765-69193787 TTTTCTTCACAGTTTTACAAAGG + Exonic
957039565 3:75327025-75327047 GTTTCTAATCAGTTTTACCAAGG + Intergenic
958265667 3:91434445-91434467 CTTTCCACACAAGTTTACTGGGG - Intergenic
962720149 3:138166185-138166207 TTTTCTACACAGTTTTCCTATGG + Intronic
962803050 3:138906574-138906596 CTTTCAACACTGGTATACTAGGG + Intergenic
963582655 3:147146513-147146535 CTTGCAACAAAGGATTACCAGGG + Intergenic
966884881 3:184371820-184371842 CTGTCTACACAGCCTTACCTGGG + Intronic
967480337 3:189965521-189965543 TTTCCTAAACAGCTTTACCAAGG + Intronic
972104807 4:35469923-35469945 TTTGAAACACAGGTTTACCAGGG - Intergenic
973082879 4:46016140-46016162 CTATCAAAACAGGTTTCCCAAGG - Intergenic
973172240 4:47160162-47160184 CTTTCTACTTAGGTTTCCCCTGG - Intronic
975516323 4:75252317-75252339 ATTTCCCCACAGTTTTACCAGGG + Intergenic
977162094 4:93647641-93647663 CTTAGGTCACAGGTTTACCACGG + Intronic
977420418 4:96792565-96792587 CTTTCTACACTCTTTTTCCAAGG - Intergenic
977753975 4:100643744-100643766 CTTTCTGCACAGGTTGACTCAGG - Intronic
978477559 4:109148031-109148053 CTTTCTACACAGTTTTAAAAGGG + Intronic
978484216 4:109231674-109231696 TTTTCTAAACAGGTTTATTAAGG + Intronic
981429188 4:144640902-144640924 CTATCTACACAGCTCTACAAGGG + Intergenic
982638785 4:157930381-157930403 CATTCTACAAAGATTTACAATGG - Intergenic
982799447 4:159685773-159685795 CTTTCTAAACAGTTTTGGCAAGG + Intergenic
989115620 5:37949585-37949607 CATTCTACAAATGTTTATCAAGG + Intergenic
994755026 5:103783850-103783872 ATTTCTACACAGGATTACTATGG - Intergenic
996024321 5:118628019-118628041 CTTTCAACTCAGGTATGCCATGG - Intergenic
996810089 5:127506842-127506864 TTTTCCACAGAGCTTTACCATGG - Intergenic
998636265 5:143958338-143958360 CCTACTACACATGTTTACTAAGG - Intergenic
1001087163 5:168708566-168708588 CTTTCTTCCAAGGTTTTCCAGGG - Intronic
1003317564 6:5026098-5026120 CTTTCAACAGAGGTTTTCCACGG - Intergenic
1007943135 6:45800746-45800768 GTTTCTAGAAAGCTTTACCAAGG - Intergenic
1008989699 6:57588209-57588231 CTTTCCACACAAGTTTACTGGGG + Intronic
1009178285 6:60486753-60486775 CTTTCCACACAAGTTTACTGGGG + Intergenic
1009929254 6:70156693-70156715 CTTTCTCCCCAGGTATCCCAGGG - Exonic
1012256997 6:97045447-97045469 CTTACTTCACAGGTGTGCCATGG + Intronic
1012403387 6:98864584-98864606 CTTGCTACACAGGTTTAGAAGGG + Intergenic
1012853851 6:104477927-104477949 CTTTTTTCATTGGTTTACCAAGG - Intergenic
1013058804 6:106611936-106611958 CTTTATACACAGGATAACAATGG + Intronic
1013500338 6:110743222-110743244 ATTTTCACACAAGTTTACCATGG - Intronic
1013949760 6:115765326-115765348 CTTTCTCCACTGGATTAGCATGG - Intergenic
1015110414 6:129586537-129586559 CCTTATATACAGGTTTATCAGGG + Intronic
1024225845 7:47326457-47326479 CCTTCTGCACAGGTTTGCCCTGG + Intronic
1024480234 7:49855085-49855107 CTATCTTCACAGCTGTACCAAGG - Intronic
1027795586 7:82689875-82689897 CTTTTTCCACAGCTTAACCAAGG - Intergenic
1027795815 7:82691822-82691844 CTTTTTCCACAGCTTAACCAAGG - Intergenic
1030938653 7:115617611-115617633 ATTTCTACACACGTTTGTCATGG + Intergenic
1031573793 7:123391253-123391275 CTTTTTAAACAGGATTTCCATGG - Intergenic
1032928854 7:136641447-136641469 CTTTCAAGACAGGTTTGCGATGG + Intergenic
1036596227 8:10214916-10214938 TTTTCAACACAGGTTTTCAAAGG - Intronic
1039008076 8:33063224-33063246 TTTTCTTCAAAAGTTTACCAGGG + Intergenic
1039614823 8:38947142-38947164 CTCTTTTCACGGGTTTACCAAGG - Intronic
1041661759 8:60407786-60407808 CTTCCCACACTGGTTTCCCATGG - Intergenic
1047944125 8:129858020-129858042 CTTTCAACATAGATCTACCATGG - Intronic
1048710489 8:137204881-137204903 CTTTCTGCACATGATTACCAAGG - Intergenic
1050823079 9:9907448-9907470 CTTTCTCCACGGCTTGACCATGG + Intronic
1051929365 9:22366806-22366828 CTTTCTCCACAGGGGTACCATGG + Intergenic
1062114654 9:134801942-134801964 CTCTCTTCACAGGGTTTCCAAGG + Exonic
1186129224 X:6448387-6448409 CTTTGTACACACCTATACCATGG - Intergenic
1188113346 X:26216865-26216887 CTTCCTCCAAAGGTTTCCCAAGG + Intronic
1189745432 X:44163507-44163529 CTGTGCACACAGGTTTGCCATGG - Intronic
1194262366 X:91712411-91712433 CTTCCTGCACAGCTTTAACATGG + Intergenic
1199005121 X:142686932-142686954 GTTTCTACATAGGTTTACTTGGG + Intergenic
1199602614 X:149551265-149551287 CTTTTTAAACAGGTTTACAAAGG + Intergenic
1199647774 X:149928210-149928232 CTTTTTAAACAGGTTTACAAAGG - Intergenic
1200581657 Y:4957246-4957268 CTTCCTGCACAGCTTTAACATGG + Intergenic