ID: 1064251608

View in Genome Browser
Species Human (GRCh38)
Location 10:13710447-13710469
Sequence CAGCTACAGCAGCCACAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064251608_1064251617 14 Left 1064251608 10:13710447-13710469 CCCGTCTGTGGCTGCTGTAGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1064251617 10:13710484-13710506 CTGCCTCCAGCTTCTGCCCTTGG No data
1064251608_1064251620 27 Left 1064251608 10:13710447-13710469 CCCGTCTGTGGCTGCTGTAGCTG 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1064251620 10:13710497-13710519 CTGCCCTTGGCTGCGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064251608 Original CRISPR CAGCTACAGCAGCCACAGAC GGG (reversed) Intronic
900516946 1:3086630-3086652 CAGCTGCAGCAGCCAGACCCAGG + Intronic
900870544 1:5299163-5299185 CACCTAGAGAAACCACAGACGGG + Intergenic
901868969 1:12126347-12126369 ATGCGACAGGAGCCACAGACAGG - Intronic
902234322 1:15047961-15047983 CAGCACCAGCAGCTACAGCCAGG - Intronic
903030826 1:20463159-20463181 GATCTGCAGCAGCCACAAACTGG + Intergenic
903360392 1:22773392-22773414 CAGCCCCACCAGCCCCAGACAGG + Intronic
903761728 1:25703225-25703247 CAGCCTCAGCACCCACAGAGAGG - Intronic
905641806 1:39595201-39595223 CAACAACAGCATCCACAGACAGG - Intergenic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
908320056 1:62970064-62970086 CAGCTGCAGACGCCACAGAACGG + Intergenic
912806651 1:112761954-112761976 CACATACATCACCCACAGACTGG - Intergenic
915436470 1:155910721-155910743 CTGCTACAGCAGCTACCAACTGG + Exonic
916713573 1:167432341-167432363 GATCAACAGCAGCCACACACAGG + Intronic
917168268 1:172138820-172138842 CCTGTACAGCAGGCACAGACAGG - Intronic
918568226 1:185955709-185955731 CAGCTCTGGCAGCCAAAGACAGG - Intronic
920650470 1:207833614-207833636 CAGCACCAGCATCCACAGTCAGG + Intergenic
921003714 1:211070708-211070730 CAGCTACAGGAGGCTGAGACAGG + Intronic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923882813 1:238122238-238122260 GAGCTACAGCATCCAAAGAAGGG + Intergenic
924845391 1:247763694-247763716 CAGCTGCATCCCCCACAGACTGG - Intergenic
1063174361 10:3538261-3538283 CACAGACAGCAGCAACAGACAGG - Intergenic
1063646833 10:7893547-7893569 CAGCAACAAAAGCCACAGACAGG - Intronic
1064251608 10:13710447-13710469 CAGCTACAGCAGCCACAGACGGG - Intronic
1064555516 10:16543346-16543368 CTGCAAGAGCAGCCACTGACTGG - Intergenic
1066048424 10:31614304-31614326 CAGCTCCTCCAGCCACAGGCTGG + Intergenic
1067540737 10:47150544-47150566 CAGCTACTGCAGCCACCAAAGGG + Intergenic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1068091936 10:52442467-52442489 CAGCCACATCAGCCACGGACTGG - Intergenic
1069954030 10:72038889-72038911 CTGCTCCACAAGCCACAGACAGG - Intergenic
1069994090 10:72332177-72332199 CGGCTGCACCAGCCAAAGACAGG - Intergenic
1070817976 10:79337064-79337086 CAGCTACTGCAGCGGCAGAAGGG + Intergenic
1071006602 10:80890703-80890725 CAGCACCAGTAGCCAGAGACTGG - Intergenic
1071399144 10:85252538-85252560 TACCTAAAGCAGCTACAGACAGG + Intergenic
1071401753 10:85280042-85280064 GAAAGACAGCAGCCACAGACAGG - Intergenic
1071686881 10:87767541-87767563 CAGCCCCTGCAGCCACAGACTGG - Intronic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1073423488 10:103442361-103442383 CATGTACTGCAGCCACAGAATGG - Exonic
1074277424 10:112017112-112017134 CAGCAACAGCAGCCCCACCCAGG + Intergenic
1075472425 10:122701781-122701803 CTGCCACAGCAGGTACAGACAGG + Intergenic
1076443414 10:130495780-130495802 GGGCTGCAGGAGCCACAGACAGG - Intergenic
1077336327 11:2006483-2006505 GAGGTACAGCTGCCACAGCCAGG - Intergenic
1077458210 11:2693664-2693686 CAGACAGAGCAGCCAGAGACTGG + Intronic
1079006326 11:16793805-16793827 CAGCCACAGAGGCCACAGACCGG + Intronic
1080527366 11:33138343-33138365 AAGCTACAGAAACCACAGGCTGG + Intronic
1080640476 11:34155585-34155607 CAGCTCCAGCCGGCACAGTCGGG + Intronic
1081436885 11:43036668-43036690 CAGCAACATCAGCCTCACACCGG - Intergenic
1081744633 11:45464285-45464307 CAGCCACAGGAGCCAGAGAGAGG + Intergenic
1081819916 11:45982729-45982751 CAGCATCAGCAGCCAGAGAAAGG + Intronic
1084176145 11:67423355-67423377 CAGCTGCAGAAGCCACAGGGTGG - Exonic
1084321644 11:68376667-68376689 CAGCTGCAGAGGCCACAGACAGG + Intronic
1084801782 11:71548805-71548827 CAGCTAGAGCAGGAACAGGCTGG - Exonic
1088624533 11:111720137-111720159 CAGGTATAGCAGACACAGCCTGG + Intronic
1089739408 11:120571950-120571972 CAGCTCCAGCTGACATAGACAGG - Intronic
1091035820 11:132232410-132232432 CAGCTGCAGCAGCGACAGGTGGG - Intronic
1091314863 11:134607279-134607301 CAGAAACAGCAGCCCAAGACAGG - Intergenic
1202819311 11_KI270721v1_random:61665-61687 GAGGTACAGCTGCCACAGCCAGG - Intergenic
1095301466 12:40589535-40589557 GAGTCACAGCAGCCACAGCCAGG - Intergenic
1096449029 12:51721755-51721777 CGGCTACAGCGGCTACAGCCAGG + Exonic
1096842972 12:54390528-54390550 CAGCTACAGCAGGGAGAGAGAGG + Intronic
1098013169 12:66076017-66076039 CAACTACAGCAGCCACTTGCAGG + Intergenic
1099661451 12:85568442-85568464 GAGGTCCAGCAGCCACCGACAGG - Intergenic
1102241614 12:111328091-111328113 CAGCTACAGTAGCCACCTCCAGG - Intronic
1102449946 12:113034138-113034160 CAGCCACTGTAGACACAGACTGG + Intergenic
1104532152 12:129582014-129582036 GAGATACAGCAGGTACAGACGGG + Intronic
1105542413 13:21326834-21326856 AAGCTACAACAGGGACAGACAGG + Intergenic
1105816278 13:24039244-24039266 CAGCAGCTGCAGCCACAGCCAGG - Intronic
1105881121 13:24607252-24607274 CAGCACCAGCTGCCACAGCCCGG - Intergenic
1106547663 13:30744513-30744535 CACCTTCAGAAGCCACAGGCAGG + Intronic
1111299686 13:86331758-86331780 CAGCTACAGGAGGCTGAGACAGG - Intergenic
1112236283 13:97640719-97640741 CAGTCAGAGCAGTCACAGACAGG + Intergenic
1112438668 13:99409425-99409447 CAGCTTCAACAGCCACACACGGG - Intergenic
1112438964 13:99411522-99411544 CAGCTTCAACAGCCACACACGGG + Intergenic
1113657627 13:112078282-112078304 CAGCAACAGCAGCCTCAGCTGGG - Intergenic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1116948420 14:50857242-50857264 CAGCTCCATCAGTCACCGACTGG + Intergenic
1117827765 14:59721245-59721267 CAGCTACAGCAGCTTGAGGCTGG - Intronic
1118946908 14:70397505-70397527 CTGCTGCAGCAGCCACACAGAGG - Intronic
1120509737 14:85398801-85398823 AAGCTAAAGAAGCCACAGCCAGG - Intergenic
1122262507 14:100531359-100531381 CAGCTTCCCCACCCACAGACAGG - Intergenic
1122471428 14:101969538-101969560 CAGCTCCAGCAGACACAAAGAGG + Intronic
1122638233 14:103140414-103140436 CAGTTACAGTAGCAACATACTGG + Intergenic
1123662211 15:22574386-22574408 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1124262007 15:28201121-28201143 CAGCCACAGCAGCCTCTGTCTGG + Intronic
1124316013 15:28668668-28668690 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1125195970 15:37046196-37046218 GAGCTGCAGCAGCCACAGTCTGG - Intronic
1125679510 15:41522184-41522206 CAGCCCCAGGAGCCACACACTGG + Exonic
1125872826 15:43117642-43117664 CAGCTAAAAGAGCCAAAGACAGG + Intronic
1126467591 15:48975048-48975070 CAGCTCCACCAGCCCCATACAGG - Intergenic
1126825762 15:52546302-52546324 CAGTTGCAGCAGCCACACCCAGG + Intergenic
1127849709 15:62902013-62902035 CAGCTACTCCAGTCACTGACTGG - Intergenic
1127961294 15:63892886-63892908 AAACCACACCAGCCACAGACAGG + Intergenic
1128272520 15:66323623-66323645 CAGCATCAGGAGCCACAGAAGGG - Intronic
1129289741 15:74555749-74555771 AGGCTACAGCTGCCATAGACAGG - Intronic
1129772645 15:78212684-78212706 GAGCCACAGCAGCCCCAGAGAGG + Intronic
1130109542 15:80953391-80953413 CAGCAAAAGAAGCCACAGAGAGG + Intronic
1130273266 15:82463380-82463402 CAGCTGCAGCATCCACACAGTGG - Intergenic
1130465617 15:84190751-84190773 CAGCTGCAGCATCCACACAGTGG - Intergenic
1130487074 15:84404069-84404091 CAGCTGCAGCATCCACACAGTGG + Intergenic
1130498648 15:84482785-84482807 CAGCTGCAGCATCCACACAGTGG + Intergenic
1130587907 15:85195346-85195368 CAGCTGCAGCATCCACACAGTGG - Intergenic
1131080679 15:89532061-89532083 CAGCTAGAGCAGACTAAGACAGG + Intergenic
1131748010 15:95471149-95471171 CAGCTACTGGTGACACAGACAGG - Intergenic
1132860096 16:2066318-2066340 CACCAACAGCTGCCACAGCCTGG - Intronic
1133078702 16:3300910-3300932 CAGATACAACAGCCTCAGTCAGG + Exonic
1134032472 16:11003468-11003490 CACCTACAGCAGCCTCCGAGTGG - Intronic
1134443097 16:14310934-14310956 CAGCTAGAGCAGGCACTGAGAGG + Intergenic
1135174802 16:20218382-20218404 GAGCAACTGGAGCCACAGACAGG - Intergenic
1136228404 16:28873558-28873580 CAGCCGCAGCAGCCAAAGAGAGG + Exonic
1136413472 16:30090543-30090565 CAGCCACAGACTCCACAGACTGG + Intronic
1136586521 16:31189765-31189787 CAGCTAAAGCAGCTATTGACTGG + Exonic
1137956516 16:52836048-52836070 CAGCCACAGCAATCACAGAAAGG - Intergenic
1139972473 16:70784836-70784858 CAGCTGCAAGAGGCACAGACAGG + Exonic
1141159361 16:81618776-81618798 CAGCGTCAGCAGCCACGGCCAGG - Intronic
1141698741 16:85632818-85632840 CCCCTACATCACCCACAGACAGG - Intronic
1141954013 16:87358092-87358114 GAGCTACTGCAGACACAGAGAGG - Intronic
1142691408 17:1608087-1608109 CCACAAAAGCAGCCACAGACAGG + Intronic
1143994599 17:10995825-10995847 CACCCACAGCAGCCACAGCTGGG + Intergenic
1145779646 17:27553793-27553815 CAGCTTCAGCTCCTACAGACTGG + Intronic
1145994297 17:29096705-29096727 CTTCTGGAGCAGCCACAGACAGG - Intronic
1146137800 17:30338315-30338337 CAGCAGCAGCAGCTACACACTGG - Intergenic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1147267565 17:39244164-39244186 AAGCTTCAACAACCACAGACAGG - Intergenic
1147848089 17:43419471-43419493 CGGCTCCAGAAGCCACACACTGG - Intergenic
1147861487 17:43526508-43526530 CAGCTACAGCAACCACAGGGAGG - Intronic
1150327315 17:64267599-64267621 CAGCAACAGATGCCACAGAATGG + Intergenic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1151554559 17:74840133-74840155 CAGCTACAGCAGCAACAGAAGGG + Intergenic
1151669501 17:75564287-75564309 CAGCCTCAACAGCCACAGGCCGG - Intronic
1151707313 17:75776239-75776261 CCACTTCAGCAGGCACAGACTGG + Intergenic
1151807042 17:76412225-76412247 AAGGTCCAGCAGCCACACACAGG + Intronic
1152463264 17:80452191-80452213 CAGCTTAAGCAGCCACTGCCTGG + Intergenic
1152549193 17:81020946-81020968 CAGTAACAGCAGCCACACCCAGG + Intergenic
1152905460 17:82968234-82968256 CACGCACAGCAGCCCCAGACTGG + Intronic
1155088145 18:22477421-22477443 CAGTGGCAGCAGCCACAGGCAGG - Intergenic
1156102551 18:33615015-33615037 CAGCTACATTAGCCCCAAACGGG + Intronic
1158910269 18:62054087-62054109 CAGCTAAAGCAAGCGCAGACGGG + Intronic
1160015230 18:75135147-75135169 CCCCCACAGCAGCCACAGAGTGG + Intergenic
1160247085 18:77167656-77167678 CAGCAGCATCAGGCACAGACAGG - Intergenic
1160602717 18:80026336-80026358 CTTTTACAGCAGCAACAGACTGG - Intronic
1160910956 19:1473609-1473631 CAGCCACAGCAGCCACTACCGGG + Exonic
1161479571 19:4503786-4503808 GAGCCACAGCAGCCACAGCTGGG - Exonic
1162668699 19:12237238-12237260 CAGCAACTGCAGCCTCAGTCCGG - Intronic
1163607023 19:18281191-18281213 CAGCTTCAGCAGCCCCAGGTCGG + Exonic
1165216393 19:34276681-34276703 CAGATACCGCAGCCACTGCCAGG + Intronic
1165867899 19:38950131-38950153 CAGCTGCAGCAGCCACACAGTGG + Exonic
1166218853 19:41353012-41353034 CAGCGGCAGCAGCCGCAGCCCGG + Exonic
1166998931 19:46733488-46733510 CAGCCTCAGCACCCACCGACAGG + Intronic
924963726 2:57341-57363 CAGCTGCAGCTGCCAAAGTCTGG + Intergenic
925989772 2:9245284-9245306 CAGCCACGGCAGCAACACACTGG - Intronic
927173850 2:20391873-20391895 CAGCAGGAGCAACCACAGACAGG - Intergenic
929770260 2:44885851-44885873 CAGCTGTAGCAGCCCCAGCCTGG + Intergenic
930725759 2:54679858-54679880 GAGCTACAGCAACCGGAGACTGG - Intergenic
931454075 2:62393318-62393340 CAGATTCTGCAGCCCCAGACAGG - Intergenic
932732019 2:74228062-74228084 CAGCTACCCCAGCCAGAGAAGGG - Intronic
932742780 2:74304545-74304567 CAGCCACAGCAGGAACTGACTGG - Exonic
932880126 2:75493439-75493461 CAGCGACAGCAGCGACAGCGAGG - Exonic
934707627 2:96495651-96495673 CAGAAACAGCAGCAACAAACTGG - Intergenic
937436850 2:121888081-121888103 CAGTCACAGCAGCCAGAGGCTGG - Intergenic
937442586 2:121929605-121929627 CAGCAACATCAGCCTCATACAGG + Intergenic
938693743 2:133816029-133816051 CAGTGACAGCAGCCATAGGCAGG - Intergenic
944223685 2:197327871-197327893 CAGCTACATGTTCCACAGACTGG - Intergenic
945011093 2:205464495-205464517 CAGCTAGAGCAGCCAGAGAGGGG + Intronic
945298301 2:208192628-208192650 CAGCTGCAGCAGCCTCAGCTGGG - Intergenic
946095402 2:217270238-217270260 CAGTAACAGCAGCCACAACCTGG + Intergenic
946112450 2:217431841-217431863 CAGTTCAATCAGCCACAGACAGG + Intronic
946196528 2:218035580-218035602 AAACTCCAGCAGCCACAGCCCGG + Intronic
947564239 2:231183935-231183957 TGGCTGCAACAGCCACAGACTGG - Intergenic
947872510 2:233447217-233447239 CAGCTGCAGACGCCACAGAGAGG - Intronic
948540984 2:238691345-238691367 CAGGGACAGCAGCCACAGGTAGG - Intergenic
948638838 2:239360400-239360422 TAGCTCCAACAGCCACAGACAGG + Intronic
949064152 2:241979695-241979717 CAGCTACAGCAAACACAGCCCGG - Intergenic
1169136210 20:3199382-3199404 CAGCCACAGCACCCACATCCAGG + Intronic
1169258694 20:4119540-4119562 CAGCTGCAGCAGCCAGGGAGAGG - Intergenic
1169416733 20:5423693-5423715 GAGCTGCAGCAGCCACAACCAGG - Intergenic
1170089121 20:12570558-12570580 CAGCTACAGCTGCCACATGGTGG - Intergenic
1170099252 20:12680751-12680773 CAGCTGGGGCAGCCACAGGCCGG + Intergenic
1170122728 20:12927784-12927806 CAGCAACTGCAGCCTCTGACCGG + Intergenic
1170493025 20:16897879-16897901 CTGCTACAGCTGCCACGGATGGG - Intergenic
1171006049 20:21466924-21466946 CAGCTACTTCAGTCACACACTGG - Intergenic
1171372145 20:24668839-24668861 CATCTGCAGCTGCCACAGACAGG + Intergenic
1172292881 20:33788843-33788865 CACCTGCAGCAGACACAGACAGG - Exonic
1172920217 20:38474595-38474617 AAGCTAATGCAGCCAGAGACAGG - Intronic
1173322580 20:42001557-42001579 CAGCTTCAGTGGCCACAGTCTGG + Intergenic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1176269834 20:64230613-64230635 CACCTGCACCAGGCACAGACTGG - Intronic
1179006115 21:37516923-37516945 CAGGTACAGCAGCTGCATACTGG - Intronic
1180127286 21:45801119-45801141 CACCTGCAGCACCCACAGCCTGG + Intronic
1181363816 22:22358351-22358373 CAGCAGCAGAAGCCACAGGCCGG - Intergenic
1183190357 22:36318530-36318552 CAGACTCAGCAGCCACATACAGG + Intronic
1183426385 22:37741569-37741591 CATCTCCAGCAGCCACAGGCTGG + Intronic
1183593785 22:38797446-38797468 CAGCTACAGGAGGCTGAGACAGG - Intergenic
1184071833 22:42151646-42151668 CATCTACAGCTGACACAGAACGG + Intergenic
950362081 3:12456647-12456669 CAGTCACTGCAGCCACAGAAGGG - Intergenic
950762618 3:15246486-15246508 CAGATGCAGAAGCCACAGCCTGG + Intronic
951072594 3:18349600-18349622 CCACAGCAGCAGCCACAGACAGG - Exonic
951728258 3:25783466-25783488 CAGCTACCGCAGCCACCGGCAGG + Exonic
958853554 3:99357588-99357610 CAAATGCAGCATCCACAGACTGG + Intergenic
960249645 3:115437881-115437903 CAAGTACAGCAGCCACAGTATGG + Intergenic
961033852 3:123628839-123628861 CAGCTGCAGCAGGCACAGGTGGG + Intronic
961338407 3:126199945-126199967 GAGTTACAGCAGCCACAGTGGGG - Intergenic
963103021 3:141623627-141623649 CAGAACCAGCAGCCACAGGCGGG - Intergenic
964044732 3:152309245-152309267 CAGGGACAGCTGCCACAGTCTGG - Intronic
966504282 3:180681505-180681527 CAGCTACAGCTGACACTGAGAGG - Intronic
967460557 3:189741178-189741200 CAGACAGAGCAGCCACAGATAGG - Intronic
968539604 4:1157989-1158011 AAGCTATAGCTGCCACAGATAGG - Intergenic
968734265 4:2287209-2287231 CTGTTACAGCAGCCCCAGACAGG + Intronic
969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG + Intronic
971461290 4:26900858-26900880 AAGCTACAGCAGTGACAGAGAGG - Intronic
976095050 4:81499744-81499766 CAGATACAACAGTCACACACAGG - Intronic
984130934 4:175875216-175875238 CAGCTCCAGAAGCCAGAAACTGG - Intronic
984437901 4:179727391-179727413 CAGCTTCAGCAGCTTCAGAATGG - Intergenic
987291581 5:16513339-16513361 GAGTTACAGCAGCCACAGTGGGG + Intronic
988509953 5:31856325-31856347 CAGCTGCAGGACTCACAGACAGG + Intronic
990476176 5:56163555-56163577 CAGCAAGAGCAGTCCCAGACAGG + Intronic
992551566 5:77865189-77865211 GAGCCACAGCAACCACACACAGG - Intronic
997236409 5:132274666-132274688 CAACTACAGCAGCCCCTGCCTGG + Intronic
997310635 5:132878022-132878044 CAGCTACAGCTGCCGAAGAGTGG - Exonic
997376939 5:133404016-133404038 CAACTTCAGCAGCCACAGGTTGG - Intronic
998654798 5:144165524-144165546 CAGCCACAACAGCCATACACCGG - Exonic
999444308 5:151627096-151627118 CAGCTACAGCAGCTACACACAGG - Intergenic
1001034787 5:168290083-168290105 CAGGGACACCAGCCTCAGACTGG - Intergenic
1001569786 5:172722978-172723000 AAGCTACAATAGCCACAGAATGG - Intergenic
1001605661 5:172958371-172958393 CAAGTACAGCAGCCACACCCAGG - Intergenic
1002190107 5:177473488-177473510 CAGCTTCAGCGGCCACCGCCTGG - Intronic
1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG + Intergenic
1004613652 6:17269236-17269258 CAGGTGCAGAAGGCACAGACTGG - Intergenic
1007114873 6:39336301-39336323 CAGCTCCAGCAACCACAGGAAGG + Exonic
1007315563 6:40985934-40985956 CAGCTGCTGCAGCCAGAAACTGG + Intergenic
1007319300 6:41015427-41015449 CAGCTCCTGCAGCCACAAAAGGG + Intergenic
1008547442 6:52595751-52595773 CAGCTCCTGCAGCCCCAGGCGGG - Intergenic
1013472049 6:110474695-110474717 CAGCTGCTCCAGGCACAGACAGG + Intronic
1015768563 6:136745460-136745482 CTGCCACAGCAGCCAGAGGCAGG - Intronic
1016489917 6:144588019-144588041 CACCTACAGCATCCATAGAGAGG - Intronic
1016803034 6:148185504-148185526 CAGCCCCTGCAGCCACCGACAGG - Intergenic
1017988437 6:159465427-159465449 CAGCTACAGCATCCCCAGAATGG - Intergenic
1018125256 6:160676560-160676582 CAGCTGCAGCACCCACAACCAGG + Intergenic
1018587317 6:165375721-165375743 CAGCTACATTAGCCCCTGACAGG - Intronic
1018978168 6:168581465-168581487 CAGCTTCAGAAGCCCCGGACGGG + Intronic
1019189800 6:170245172-170245194 CAGACAAAGCGGCCACAGACAGG - Intergenic
1019742205 7:2680529-2680551 CAGCAACCCCAGCCACAGAGGGG - Intronic
1020423431 7:8036062-8036084 CAGCTACAGCAGAAGCAGATGGG - Intronic
1021675983 7:23081292-23081314 CAGCAACAGTAGCCACAGCATGG + Intergenic
1027251411 7:76400943-76400965 CAGGTACTCCAGCCTCAGACAGG - Intronic
1030294938 7:107914318-107914340 CAAAAACAGAAGCCACAGACTGG - Intronic
1033228896 7:139581616-139581638 CAGCTACAGCACCCAGAGCATGG - Intronic
1034412118 7:150947222-150947244 CAGCTGCTGCACACACAGACAGG + Intronic
1038075017 8:24062669-24062691 CAGCCACAAGAGCCACTGACAGG - Intergenic
1041514642 8:58687370-58687392 CAGCTGCAGCAGCTACATGCAGG + Intergenic
1042633269 8:70844404-70844426 CAGTGACTGCAGCCACACACAGG - Intergenic
1045037218 8:98184939-98184961 CAACTCCCTCAGCCACAGACAGG - Intergenic
1045696139 8:104810776-104810798 CAGCTCCAGTAGCCCCAGAATGG + Intronic
1045727105 8:105186483-105186505 CAGCAATGGCATCCACAGACTGG + Intronic
1045741917 8:105370605-105370627 GGACTTCAGCAGCCACAGACTGG + Intronic
1046707284 8:117469030-117469052 CAGCTACAAAAGACAGAGACTGG - Intergenic
1047767332 8:128000530-128000552 CATAATCAGCAGCCACAGACTGG - Intergenic
1048128093 8:131659771-131659793 TAGCTCCAGCATCCACATACAGG + Intergenic
1048651957 8:136487810-136487832 CAGCTTGAGCATCCACAGAAGGG + Intergenic
1049042286 8:140121555-140121577 CAGCAACAGAAGCCCCAGAGAGG + Intronic
1049296315 8:141841767-141841789 AAGCTAAAGAAGCCACAGAGGGG - Intergenic
1049543198 8:143217926-143217948 CAGCTATAGAAGCCAGAGAGGGG + Intergenic
1049685459 8:143937556-143937578 CAGCCACAGCAGCCACCGGTGGG + Intronic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1056838435 9:89977214-89977236 CAGCTACAGTAGCCACATTCTGG - Intergenic
1057125447 9:92612622-92612644 CACCTAGAGCAGCCACACCCAGG - Intronic
1057268853 9:93635968-93635990 CAACTGCCACAGCCACAGACAGG - Intronic
1057453514 9:95187220-95187242 CAGATACAGCAGCATCAGATGGG - Intronic
1057474739 9:95388804-95388826 CAGATACAGCAGCATCAGATGGG + Intergenic
1057796350 9:98160735-98160757 CATCACCAGCTGCCACAGACAGG - Intronic
1059053324 9:110952673-110952695 CAGTGGCAGCAACCACAGACAGG - Intronic
1059522394 9:114955866-114955888 CACGTACATCAGACACAGACTGG - Intergenic
1060772528 9:126342919-126342941 CAGCTACAACAGACAGAGAGAGG - Intronic
1060878932 9:127104241-127104263 CAACAGCAGCTGCCACAGACGGG - Intronic
1061060219 9:128246517-128246539 GGGCTGCAGCAGCCACAGCCAGG - Intronic
1061166916 9:128928282-128928304 CAGCTCCTGCAGCCAGAGACAGG + Intronic
1061534409 9:131238809-131238831 CAGCTGCAGAGGCCACAGGCAGG + Intergenic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1061838821 9:133346122-133346144 CAGCTACAGCTGCATCAGATTGG - Intronic
1061855764 9:133441244-133441266 CCCCTACAGCAGCCAGAGACAGG + Intronic
1062547282 9:137069494-137069516 CTGCCTGAGCAGCCACAGACAGG + Intronic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1189447941 X:41098512-41098534 GAGCAACAGCAGCCAGATACAGG - Intronic
1191190483 X:57661317-57661339 GAGGTACAGCAGTAACAGACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194252610 X:91596111-91596133 CTGCTACAGGATCCACAGGCAGG - Intergenic
1196310724 X:114162213-114162235 CAGTGGCAGCAGCCACAGGCAGG + Intergenic
1196593540 X:117517028-117517050 AAGCAACAGCAGCCAGTGACTGG + Intergenic
1197350610 X:125378169-125378191 CAGCTAGAGCAGGAACATACTGG + Intergenic
1199462426 X:148099405-148099427 CAGCAACAGCAGCCTAAAACAGG + Intergenic
1200571542 Y:4837368-4837390 CTGCTACAGGATCCACAGGCAGG - Intergenic
1202369616 Y:24187973-24187995 CAGCTGCAGCATCCACACAGTGG + Intergenic
1202501169 Y:25482144-25482166 CAGCTGCAGCATCCACACAGTGG - Intergenic