ID: 1064255842

View in Genome Browser
Species Human (GRCh38)
Location 10:13742261-13742283
Sequence TCCGAAAGCGGGGGTGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255842_1064255859 20 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255842_1064255855 7 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data
1064255842_1064255858 14 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255842_1064255853 -3 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255853 10:13742281-13742303 GGAAGGGCAGAGCCAACCTGGGG No data
1064255842_1064255852 -4 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255852 10:13742280-13742302 CGGAAGGGCAGAGCCAACCTGGG No data
1064255842_1064255854 6 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data
1064255842_1064255851 -5 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255851 10:13742279-13742301 TCGGAAGGGCAGAGCCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255842 Original CRISPR TCCGAAAGCGGGGGTGGGAG CGG (reversed) Intronic
900337682 1:2172655-2172677 ACAGAAAGCGGGGGTGGGACAGG + Intronic
900611839 1:3547578-3547600 TCCGAAGGCGGGAGGGGGAGTGG - Intronic
901731336 1:11282317-11282339 TCAGAAAATGGGGTTGGGAGAGG + Intronic
902246648 1:15125048-15125070 TCAGAAAGCAGGGGTGGACGTGG - Intergenic
902376149 1:16030776-16030798 TCCGACATGGGGGCTGGGAGGGG + Intronic
902939921 1:19793694-19793716 TGCTGAAGCGAGGGTGGGAGGGG - Intronic
904266611 1:29321971-29321993 GCAGAAAGCTGGGGTGGGAAGGG - Intronic
905599916 1:39240943-39240965 TTGGAGAGCGGGGGTGGGAGGGG - Intronic
906059649 1:42940173-42940195 TCCAAAAGAGTTGGTGGGAGAGG - Intronic
915061961 1:153193610-153193632 TCCGAAAGAGATGGTGGGATTGG + Intergenic
915530456 1:156499947-156499969 TTGGGAAGCGGGGGAGGGAGGGG - Intronic
915955155 1:160214683-160214705 GGCCAGAGCGGGGGTGGGAGGGG + Exonic
917513336 1:175686637-175686659 TCCAAAAGAGGGGGATGGAGGGG - Intronic
923126637 1:231039809-231039831 CCCGAAAGGGCGGGTGGGCGCGG + Intronic
1063395745 10:5685307-5685329 TCCGGGTGAGGGGGTGGGAGGGG + Intronic
1064219395 10:13427647-13427669 TCAGAAAGAGGGGGTGGGAGGGG + Intergenic
1064255842 10:13742261-13742283 TCCGAAAGCGGGGGTGGGAGCGG - Intronic
1065445254 10:25791712-25791734 TTGGAAAGCTGAGGTGGGAGGGG + Intergenic
1069123503 10:64599386-64599408 TCCAAAAGGGGGGGTGCGGGAGG - Intergenic
1069578894 10:69551636-69551658 CCAGAATGCGGAGGTGGGAGTGG - Intergenic
1069927088 10:71858310-71858332 GCCAAAGGCGGGGGCGGGAGAGG - Intergenic
1071288729 10:84172845-84172867 TCAGAAGGTGGGGGAGGGAGGGG - Intergenic
1072034916 10:91554836-91554858 TCTGGAAGCGGGGGTGTGAGGGG - Intergenic
1072700135 10:97634508-97634530 CCCGAAAGTGGGGGTGGGGGTGG + Intronic
1075401328 10:122163482-122163504 TCCGGAAACGGGGCTGGGGGTGG - Intronic
1075528661 10:123208391-123208413 TCCGAAAGCAGTGGTAGCAGTGG - Intergenic
1076177301 10:128377908-128377930 TCAGGCAGCGGTGGTGGGAGTGG - Intergenic
1076298932 10:129409846-129409868 TCCTAAAGCTGGGGTTGGATGGG + Intergenic
1076416689 10:130295864-130295886 TGCGAAAGCGGTGGGGGGAGGGG + Intergenic
1077415785 11:2423684-2423706 TCAGCAAGCGGGGGTAGAAGAGG + Intergenic
1078962457 11:16293619-16293641 TCCTTAAGTAGGGGTGGGAGTGG + Intronic
1084680181 11:70662395-70662417 TCCGCAGGCTGGGCTGGGAGAGG + Intronic
1084933520 11:72575095-72575117 TCCCCAGGTGGGGGTGGGAGTGG - Intergenic
1085152993 11:74267171-74267193 GCCAAAAGCTGGGGTAGGAGAGG - Exonic
1086076955 11:82864961-82864983 GGGGACAGCGGGGGTGGGAGAGG + Intronic
1087060135 11:93969340-93969362 TGGGATAGCAGGGGTGGGAGAGG - Intergenic
1090645216 11:128761646-128761668 TCTGAGAGCAGGGGAGGGAGTGG - Intronic
1091673132 12:2467251-2467273 TCCGAATGTCTGGGTGGGAGGGG + Intronic
1092291695 12:7163225-7163247 TCCGATGGGGGAGGTGGGAGAGG - Intergenic
1093787537 12:23210154-23210176 GGAGAAAGCTGGGGTGGGAGAGG - Intergenic
1096227894 12:49881177-49881199 TCCCAGAGCCGGGGTGGGTGGGG - Intronic
1096838794 12:54368999-54369021 ACGGAAATCGGGGGTGGGGGAGG - Intergenic
1098584527 12:72140379-72140401 ACTGGAAGCGGGGGTGGGGGTGG - Intronic
1098925781 12:76348407-76348429 ACCGAAAACAGGGGTGGGAACGG + Exonic
1099443442 12:82725737-82725759 TTCGAAACCAGGGGTGGGTGGGG + Intronic
1100408517 12:94291902-94291924 TCCAAAAGCGGGGATGGGTCTGG - Intronic
1103594193 12:122013634-122013656 TCCGGTAGCGGGGTGGGGAGGGG + Intergenic
1103715539 12:122943294-122943316 TCAGGAAACGGGGGTGGGAGTGG - Intronic
1103898931 12:124293466-124293488 GACGAAAGCGGTGGGGGGAGGGG - Intronic
1106151596 13:27108849-27108871 TCAGGAAGCTGGGGTGGTAGAGG + Intronic
1106206874 13:27605968-27605990 TCTGAAAAGGGGTGTGGGAGAGG - Intronic
1106774804 13:32998630-32998652 TCTGAGAGCAGGGGTGGGAGAGG + Intergenic
1107212080 13:37869862-37869884 TGTGCAGGCGGGGGTGGGAGAGG - Exonic
1108300961 13:49075813-49075835 TCTGAAAGGGGGGGTGGGGGTGG - Intronic
1108590451 13:51908296-51908318 TCAGAATGTGGGGGTGGGGGTGG + Intergenic
1110760367 13:79224321-79224343 TCTGTAAGCTGGGGTGGGGGTGG - Intergenic
1114193935 14:20461103-20461125 TCTGAAAGCCGGGGAGGGGGCGG - Intronic
1115028111 14:28766328-28766350 TTTGAAAGCGGGGGTGGTGGTGG - Intergenic
1115474535 14:33800543-33800565 GCCGAGAGCGGGGGTGACAGCGG - Exonic
1117202912 14:53410866-53410888 TCAGAAGGCAGGGGTGGGTGGGG + Intergenic
1117234785 14:53760986-53761008 GCAGAAAGTGGTGGTGGGAGGGG + Intergenic
1117257025 14:53988271-53988293 TCCTAAAGATGGGTTGGGAGGGG + Intergenic
1117913426 14:60655127-60655149 TCAGAATGCGGGGGTGGGGGGGG - Intronic
1118777090 14:68979690-68979712 TCCAAACCCCGGGGTGGGAGGGG + Intergenic
1120526122 14:85579071-85579093 TCCAGAAGGGAGGGTGGGAGAGG - Intronic
1121079420 14:91095779-91095801 ACGGAAAGCTGGGGAGGGAGGGG - Intronic
1121413678 14:93764279-93764301 GCTGAAGGCGGGGGTGGGGGAGG - Intronic
1121608050 14:95255696-95255718 TCCTGAAGTGGGCGTGGGAGGGG - Intronic
1124880746 15:33640274-33640296 TCAGAAAGCGGCTGTGGCAGGGG + Intronic
1126337711 15:47605169-47605191 TCTGAATGCTGGGCTGGGAGTGG + Intronic
1126732729 15:51700835-51700857 TCAGAAAGCTGGGGTGGGGTGGG + Intronic
1127389054 15:58490708-58490730 TCTGAACCCGGGGCTGGGAGTGG + Intronic
1128231635 15:66039637-66039659 GGAGAAAGCAGGGGTGGGAGGGG - Intronic
1130991146 15:88876894-88876916 TCCTGAGGCGGGGGTGGGAGTGG + Intergenic
1134012943 16:10868720-10868742 TCGGAAAGAGGGGGTGGGAGGGG - Intergenic
1134014684 16:10879756-10879778 TGCGAATGCCGGGGTGGGAGTGG + Intronic
1136283948 16:29230516-29230538 CCCAAAGCCGGGGGTGGGAGCGG - Intergenic
1136287652 16:29253805-29253827 TCCTACAGCTGGGGTGGGAAGGG + Intergenic
1136396667 16:29996226-29996248 TCCGGAAGTGGAGGCGGGAGCGG + Exonic
1136704255 16:32172960-32172982 TGCGAGAGTGGGTGTGGGAGAGG - Intergenic
1138341000 16:56289025-56289047 TCCAAAAAAGGGGGGGGGAGCGG + Intronic
1141164431 16:81651079-81651101 TCAGAAAGAGGAGGGGGGAGAGG - Intronic
1141416663 16:83880756-83880778 TCGGAAGGCTGGGGAGGGAGGGG - Intergenic
1142088980 16:88200026-88200048 CCCAAAGCCGGGGGTGGGAGCGG - Intergenic
1142150761 16:88511616-88511638 TTGGAAAGTGGGGGTGGGTGAGG - Intronic
1203065804 16_KI270728v1_random:1016767-1016789 TGCGAGAGTGGGTGTGGGAGAGG + Intergenic
1143868830 17:9943406-9943428 TCAGAAAGCGCTGTTGGGAGTGG - Intronic
1146059714 17:29598068-29598090 CCCGGCAGCGGGAGTGGGAGAGG - Intronic
1146398534 17:32486896-32486918 GCCGGAAGCGGGAGCGGGAGCGG + Exonic
1147877513 17:43632182-43632204 GCCCAAAGCAGGGGTGGGGGTGG + Intergenic
1148565166 17:48628232-48628254 TCGGAGAGCAGGGGTGGGAAAGG - Intronic
1148853463 17:50565925-50565947 TCCCAAAGAGGGGGTAGGAGAGG - Intronic
1149760143 17:59221263-59221285 TCGGAACGTGGGGGTGGGACGGG - Intronic
1150523962 17:65901975-65901997 TCCCAAAACGGGGGGGGGGGGGG + Intronic
1151033294 17:70767460-70767482 TCCAAAAAGGGGAGTGGGAGAGG - Intergenic
1151353091 17:73543056-73543078 TGCAAAAGAGGGGATGGGAGAGG + Intronic
1152120038 17:78412939-78412961 TGGGGAAGAGGGGGTGGGAGGGG + Intronic
1152245529 17:79182989-79183011 TCCGAAGGCGCGGGAGGGGGCGG - Intronic
1152345312 17:79747634-79747656 TCAGAAGGCGGGCGTGGGGGAGG - Intergenic
1152677135 17:81647425-81647447 ACAGAAAGCAGGGGTGGGGGAGG - Intronic
1157285361 18:46373858-46373880 TCTGGGACCGGGGGTGGGAGGGG - Intronic
1157314481 18:46576375-46576397 TGAGAAGGCTGGGGTGGGAGAGG - Intronic
1158458031 18:57624406-57624428 TCCGAAGGCTTGGGTGGGTGGGG + Intergenic
1161410590 19:4115040-4115062 CCCGAAAACTCGGGTGGGAGAGG - Intronic
1161771635 19:6234038-6234060 TCCAGCAGCAGGGGTGGGAGGGG + Intronic
1162280599 19:9694299-9694321 TCAGGAGGCTGGGGTGGGAGGGG - Intronic
1162313052 19:9918850-9918872 CCTGCAAGTGGGGGTGGGAGTGG + Intronic
1164559489 19:29279506-29279528 TCCAAAAGCCGAGGTGGGAGGGG - Intergenic
1164563952 19:29312597-29312619 ACCGAAAGGGGGAGTGGGTGTGG + Intergenic
1165065149 19:33224455-33224477 TGCTAATGTGGGGGTGGGAGAGG + Intronic
1165875165 19:39001352-39001374 TCCTAAAGAGGGGGTGTGGGTGG + Intronic
1165929573 19:39347984-39348006 TGTGAAAGAGAGGGTGGGAGTGG + Intronic
1165959035 19:39519184-39519206 TCCCAAGGCTGCGGTGGGAGGGG + Intronic
1167075029 19:47243312-47243334 TGCGAAATCGGGGCGGGGAGGGG - Intergenic
1167566516 19:50260988-50261010 TGAGGAAGCGGGGGTGGGGGCGG - Intronic
1168238231 19:55076520-55076542 GCCGCAAGCGGGTGTGGGTGAGG - Intronic
930248854 2:49013122-49013144 TGAGAAAGTGGGGGTGGGGGGGG - Intronic
932413231 2:71559399-71559421 TACTAAAGGAGGGGTGGGAGAGG - Intronic
932888671 2:75571082-75571104 ACTGAAAGCGTGGTTGGGAGGGG + Intergenic
936029369 2:109059088-109059110 TTCCAAAGCGGGGGTGGGGAAGG + Intergenic
937624269 2:124025532-124025554 TCTCCAAGCGGGGGTGGGAGGGG + Exonic
938407574 2:131040938-131040960 GCCAAAAGCGGCGGTGGTAGGGG - Intronic
942053064 2:172158636-172158658 CCTGAAACCGGAGGTGGGAGTGG + Intergenic
942327552 2:174788596-174788618 TACGGAAGCGGGGGCGGGGGGGG + Intergenic
943719732 2:191191211-191191233 GTCGAAAGCCGGGGTGGGTGAGG + Intergenic
944306542 2:198186242-198186264 TGAGAGAGTGGGGGTGGGAGTGG - Intronic
945436398 2:209823494-209823516 TCCGAAAGCAGAGGTTGGACTGG - Intronic
946365072 2:219243998-219244020 TCCGAGGGTGGGGGTGGGGGTGG + Intronic
947556973 2:231101676-231101698 GCTGAAAGCTGGGGTGGGTGTGG - Intronic
948199469 2:236119493-236119515 TCCGAAATAGGGGGTGTGTGTGG - Intronic
949018414 2:241726570-241726592 TCCGAGGGTGTGGGTGGGAGTGG + Exonic
1168972281 20:1938914-1938936 TCAGAAAGCCGGGATGGGGGCGG - Exonic
1170551100 20:17476988-17477010 TCAGTATCCGGGGGTGGGAGAGG + Intronic
1172646385 20:36472860-36472882 TCCCAGAGCAAGGGTGGGAGTGG - Intronic
1174724112 20:52843443-52843465 TCAGAAGGCTGGGTTGGGAGAGG + Intergenic
1176077403 20:63254623-63254645 GCCGCAGGCGGGGGTGGGAGGGG - Intronic
1177108485 21:16992541-16992563 TCTGATGGCGGGGGTGGGGGCGG + Intergenic
1177138664 21:17334103-17334125 TGGGAAAGCGGGGGTATGAGGGG - Intergenic
1184135797 22:42549177-42549199 GCAGCAAGCGGGGGTGGGGGAGG - Intergenic
1184457972 22:44622113-44622135 TCCTGAAGCAAGGGTGGGAGGGG + Intergenic
1184519061 22:44981677-44981699 TCAGAAAGGAGGGGAGGGAGGGG + Intronic
949231299 3:1754116-1754138 TTCAAAAGCGGGGGGGGGTGGGG + Intergenic
954900858 3:54018364-54018386 TTCGGGAGTGGGGGTGGGAGAGG + Intergenic
961144879 3:124585209-124585231 TGCGGACGCGGGGGTGGGAAGGG + Intronic
962153623 3:132919887-132919909 TCGGAAGGGGAGGGTGGGAGGGG + Intergenic
962309141 3:134313325-134313347 TCCAAAAGGCGGGCTGGGAGCGG + Intergenic
962732937 3:138299801-138299823 TCCCAAAGCAGGGGAGAGAGGGG - Intronic
963570035 3:146982175-146982197 TCCCAGAGCATGGGTGGGAGAGG - Intergenic
967085198 3:186088538-186088560 TCCAAGAATGGGGGTGGGAGGGG + Intronic
967168393 3:186804788-186804810 TAGGAAAGCGGGGGTGGTGGTGG + Intronic
967858610 3:194135471-194135493 TCTGAAAGACGGGGTGGGGGTGG + Intergenic
968549778 4:1216263-1216285 CCCGAAAGCCAGGGTCGGAGTGG + Intronic
968578806 4:1380243-1380265 CCCGAGGGCGGGGGTGGGTGTGG + Intronic
975384257 4:73737247-73737269 TCCTATGGCGTGGGTGGGAGGGG + Intergenic
976725406 4:88211359-88211381 TCCAAAAGTGGGGGGGGGTGGGG - Intronic
979231473 4:118352828-118352850 TCCGCGTGCGGGGGCGGGAGGGG - Exonic
980914082 4:139018088-139018110 TACGAAATTGGGGGTGGGGGTGG - Intronic
980988430 4:139717824-139717846 TCCAAAAGGGGGATTGGGAGGGG + Exonic
981027559 4:140092340-140092362 TCCAAAAGGGGGAGTGGGACTGG + Intronic
981546792 4:145902297-145902319 TCTGAAGGCGGGGGCGGTAGAGG + Exonic
981688355 4:147480393-147480415 TCCTAAATTGGGGGTGGGAGAGG - Intergenic
982326788 4:154136854-154136876 ACCGAAAGCGGGGGTTGGAGTGG + Intergenic
984811034 4:183797172-183797194 TCAGAAAGCGGGGGTTGCGGGGG - Intergenic
986399807 5:7369982-7370004 TCCAAGGACGGGGGTGGGAGTGG + Intergenic
988793650 5:34632392-34632414 TCCAAAAACGAGGTTGGGAGTGG + Intergenic
995407058 5:111810102-111810124 ACCGAAAGAGGGGTTGGGGGAGG + Intronic
997444921 5:133933854-133933876 TGTGTGAGCGGGGGTGGGAGCGG - Intergenic
997472163 5:134123174-134123196 TCCAAAAGCTGAGGTGGGACTGG + Intronic
997614940 5:135239880-135239902 TCCGAAAGTAGGTATGGGAGAGG - Intronic
1004347017 6:14857837-14857859 GCTGAAGGCGGGGGTGGAAGTGG - Intergenic
1005104303 6:22206761-22206783 TCCCACAGTGGTGGTGGGAGGGG - Intergenic
1005973150 6:30777311-30777333 TCGGAAGGCTGAGGTGGGAGAGG - Intergenic
1006782835 6:36643718-36643740 TCTGAACGAGGGGGTGGGGGAGG - Intergenic
1007029646 6:38616509-38616531 TCGGAAAGTTGAGGTGGGAGTGG + Intronic
1007231315 6:40349338-40349360 TGCCACAGCCGGGGTGGGAGGGG - Intergenic
1014137819 6:117908223-117908245 TCGCAAAGCCGGGGTGCGAGAGG - Intronic
1014741633 6:125154093-125154115 ACCAAAGGCGCGGGTGGGAGTGG - Intronic
1016086423 6:139920630-139920652 TCAGAAGGCGGGGGCGGCAGGGG + Intergenic
1019277466 7:183287-183309 ACCGACAGCTGGGGAGGGAGGGG + Intergenic
1019719449 7:2559405-2559427 TGCGAAAGCGGGCGCGGGCGAGG - Intronic
1021868682 7:24981881-24981903 TCCGACGGCGGGGCTGGGCGTGG - Intergenic
1022810176 7:33860770-33860792 CACGAAAACAGGGGTGGGAGTGG + Intergenic
1023791941 7:43759221-43759243 AACGAAAGCGGGGCTAGGAGAGG - Intronic
1029374341 7:100168785-100168807 TGTGAAAGCGGGGGCGGAAGTGG - Intergenic
1034399052 7:150849376-150849398 TGTGAGGGCGGGGGTGGGAGTGG - Intronic
1035650676 8:1261546-1261568 GCCGAGGGTGGGGGTGGGAGGGG + Intergenic
1038259436 8:25980149-25980171 CGGAAAAGCGGGGGTGGGAGGGG + Intronic
1039117351 8:34106540-34106562 TGGGAAAACGAGGGTGGGAGAGG + Intergenic
1041170860 8:55141123-55141145 TGGGAAGGCGTGGGTGGGAGGGG - Intronic
1043578257 8:81682730-81682752 TTAGAAGGCGGGGGTGTGAGTGG - Intronic
1045934992 8:107669063-107669085 TCAGAGAGCAGGGGTGGGATCGG + Intergenic
1047222256 8:122928003-122928025 TACGAAAGCGGGGAGAGGAGAGG - Intronic
1048255437 8:132901634-132901656 TGGGAAGGCAGGGGTGGGAGGGG + Intronic
1048899887 8:139027266-139027288 GCCGGAAGCGGGGGATGGAGTGG - Intergenic
1049197974 8:141325811-141325833 ACAGAAGGCGGGGGTGGGGGTGG + Intergenic
1049802757 8:144525789-144525811 TGGGAAAGCTGGGGTGGGACAGG + Exonic
1051599529 9:18858792-18858814 CCAGAAAGCGGGAGTGGAAGGGG - Intronic
1053102324 9:35381243-35381265 TCAGAAAGCAGTGCTGGGAGAGG + Intronic
1059284730 9:113162578-113162600 TCTGGGGGCGGGGGTGGGAGGGG + Intronic
1061490899 9:130943753-130943775 TACAAAGGCGGGGGTGGGGGTGG + Intergenic
1061720593 9:132548697-132548719 TCCGAGGGTGGGGGCGGGAGGGG - Intronic
1062460828 9:136661915-136661937 ACGGACAGCGGGGTTGGGAGAGG + Intronic
1185711478 X:2307305-2307327 TCCAAGAGCAGGGGAGGGAGAGG + Intronic
1188486868 X:30691728-30691750 TCCCAAAGTGCTGGTGGGAGGGG + Intronic
1189127137 X:38460756-38460778 TTCCAAAGACGGGGTGGGAGGGG + Intronic
1189599558 X:42608384-42608406 TGCGAAAGGGGAGGTGGGAAAGG - Intergenic
1189821531 X:44873586-44873608 ACCGAAAGCGGCGGCGGCAGCGG - Exonic
1192369940 X:70504781-70504803 TCCGAAAATGAGGGTGGGATGGG + Exonic
1192450390 X:71241110-71241132 TGCAACATCGGGGGTGGGAGTGG + Intronic
1197647944 X:129037693-129037715 CCAGGAAGTGGGGGTGGGAGGGG + Intergenic
1200147775 X:153935298-153935320 TCGGCAGGCGGGGGTGGGGGCGG + Exonic
1200820756 Y:7580405-7580427 CCAGAAAGCGGAGGTGGCAGTGG + Intergenic
1202239550 Y:22752337-22752359 CCAGAAAGCGGAGGTGGCAGTGG - Intergenic
1202392537 Y:24386099-24386121 CCAGAAAGCGGAGGTGGCAGTGG - Intergenic
1202478247 Y:25284018-25284040 CCAGAAAGCGGAGGTGGCAGTGG + Intergenic