ID: 1064255845

View in Genome Browser
Species Human (GRCh38)
Location 10:13742266-13742288
Sequence GCCCTTCCGAAAGCGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255845_1064255854 1 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data
1064255845_1064255851 -10 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255851 10:13742279-13742301 TCGGAAGGGCAGAGCCAACCTGG No data
1064255845_1064255859 15 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255845_1064255852 -9 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255852 10:13742280-13742302 CGGAAGGGCAGAGCCAACCTGGG No data
1064255845_1064255855 2 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data
1064255845_1064255853 -8 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255853 10:13742281-13742303 GGAAGGGCAGAGCCAACCTGGGG No data
1064255845_1064255858 9 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255845 Original CRISPR GCCCTTCCGAAAGCGGGGGT GGG (reversed) Intronic
903349664 1:22710410-22710432 GGGCTTCCCAAAGCGGGGGCCGG - Intergenic
904266615 1:29321976-29321998 GCCCAGCAGAAAGCTGGGGTGGG - Intronic
912608795 1:111021324-111021346 GCCCTTCAGAAGGCTGAGGTGGG + Intergenic
914004427 1:143720119-143720141 ACTCTTCTGAAAGGGGGGGTTGG + Intergenic
916053901 1:161054471-161054493 GTCCTGCAGAAAGCGGGGGCAGG + Exonic
923029335 1:230234965-230234987 GCACTTCAGAAAGCTGAGGTGGG + Intronic
923380594 1:233413978-233414000 GCCCTCCCTAATGTGGGGGTCGG + Intergenic
924754147 1:246926607-246926629 GCACTTCGGAAAGCTGAGGTGGG + Intronic
924947917 1:248858349-248858371 GCCCTGCCGATCTCGGGGGTCGG + Intronic
1064255845 10:13742266-13742288 GCCCTTCCGAAAGCGGGGGTGGG - Intronic
1069629502 10:69889165-69889187 GCCCTTCAGAGAGCAGGGGTGGG - Intronic
1075430729 10:122378487-122378509 GCACTTCAGAAAGCCGAGGTGGG + Intronic
1075519319 10:123134779-123134801 GCCCTTCCGAGAGCAGCCGTCGG + Intergenic
1075653374 10:124144968-124144990 GCCCTTCAGAAATCAGGGGAAGG + Intergenic
1076298929 10:129409841-129409863 CCCATTCCTAAAGCTGGGGTTGG + Intergenic
1081814267 11:45929756-45929778 GCCCTCCAGAAAGCCGGGGTAGG - Intronic
1083911615 11:65713232-65713254 GTCCTTCAGAAGGCGAGGGTGGG + Intronic
1084274326 11:68043920-68043942 GGCCTTCCGGAGGCGGGTGTAGG + Intronic
1084553266 11:69861627-69861649 GCCCCTCCAAAAGCGGGGGCTGG - Intergenic
1084995737 11:72976524-72976546 GCACTTTGGAAGGCGGGGGTGGG - Intronic
1085056768 11:73409162-73409184 GCCCTTCGGAAATAGGGGCTTGG - Intronic
1089717832 11:120380722-120380744 CCCCTTCCTAAAGTGTGGGTTGG - Intronic
1096252062 12:50039847-50039869 GCCATTCTGAAAGTGGGGCTGGG + Intergenic
1097228009 12:57490338-57490360 GCCCTTCCCTCAGCGGGGCTGGG - Exonic
1099932000 12:89085602-89085624 GCACTTCCGAAAGGGTGGGCTGG - Intergenic
1106782142 13:33069998-33070020 GCACTTTCGAAAGCGTGGGCTGG - Intergenic
1113654110 13:112057428-112057450 GCGCTGCCGAACGCGAGGGTGGG - Intergenic
1117591493 14:57273184-57273206 GCACTTCAGAAAGCTGAGGTGGG - Intronic
1118083896 14:62393772-62393794 GCCCTTCTGTTAGAGGGGGTGGG + Intergenic
1120747513 14:88165596-88165618 GACATCCCGAAAGTGGGGGTTGG + Intergenic
1126397342 15:48232911-48232933 GGCATTCCGAAGGCTGGGGTTGG - Intronic
1129154706 15:73710555-73710577 GCCCTTCCTTCTGCGGGGGTGGG - Intronic
1133000696 16:2850073-2850095 GCCCTCCCCAAACCGGGGGGGGG - Intergenic
1133311233 16:4847874-4847896 GCGCCTCCGAAAGCGGCCGTCGG - Intronic
1135212467 16:20535196-20535218 GCCCTCCCTAATGTGGGGGTGGG + Intergenic
1139460269 16:67116601-67116623 GCACTTTAGAAAGCGGAGGTGGG + Intronic
1141771427 16:86092057-86092079 GCCATTCCCAAATCGGGGCTTGG + Intergenic
1142065688 16:88061028-88061050 GCCCTGCTGGAAGGGGGGGTGGG + Intronic
1143067755 17:4263510-4263532 GCTCTTCCGCAAGCGAGGGATGG + Intronic
1144124342 17:12188680-12188702 GCCCTTCCTGAGGTGGGGGTGGG - Intergenic
1144787221 17:17838538-17838560 GCCCTTCCCAGGGAGGGGGTGGG + Intergenic
1146236950 17:31175459-31175481 GCACTTTCGAAAGCAGGAGTGGG - Intronic
1148497317 17:48060560-48060582 GCTCTTCTGTAAGCTGGGGTAGG + Exonic
1152037069 17:77880129-77880151 GCCCTTCTGAAAGCAGAGGCAGG + Intergenic
1152078594 17:78172983-78173005 TCCCTTCCTAGAGTGGGGGTGGG + Exonic
1157328413 18:46685828-46685850 GCCCTTCCAGAAGCAGTGGTTGG - Intronic
1167209522 19:48124766-48124788 GCGCTTTGGAAAGCGGAGGTGGG + Intronic
929130622 2:38566120-38566142 GCACTTCGGAAGGCGGAGGTGGG + Intronic
929877601 2:45809635-45809657 GCCCTTCGGAAGGCTGAGGTGGG + Intronic
937425296 2:121794046-121794068 GCACTTCAGAAGGCGGGGGCGGG - Intergenic
1174636904 20:52008773-52008795 GCCCTTCAGAAAGTGGTGGCCGG - Intergenic
1176372460 21:6070600-6070622 GCCCTTCCGCAAGATGGGGATGG - Intergenic
1179704478 21:43173028-43173050 GCACTTCCGAGAGCTGGGGGCGG + Intergenic
1184258636 22:43301827-43301849 GCACTTCCAAAAGTGTGGGTGGG + Intronic
953612176 3:44456167-44456189 GCACTTTGGAAAGCGGAGGTGGG + Intronic
960666352 3:120112600-120112622 GCACTTCGGGAAGCGGAGGTGGG + Intergenic
964767951 3:160196899-160196921 GCCCATCTGAGAGTGGGGGTTGG + Intergenic
967028869 3:185587377-185587399 GCACTTCCAAAGGCTGGGGTGGG - Intronic
980202248 4:129670766-129670788 GCACTTCCAACAGCTGGGGTGGG + Intergenic
981931884 4:150198913-150198935 GCCCTACAGAAAGTGGGGGGGGG - Intronic
985426019 4:189831323-189831345 GCCCTTAAGAAATTGGGGGTAGG - Intergenic
998148961 5:139746406-139746428 GCCCTGCAGAAGGCGGGGCTGGG + Intergenic
1002121261 5:177006428-177006450 GCCTTGCCGAAGTCGGGGGTGGG - Intronic
1006475327 6:34249144-34249166 GCCAATCCGGAGGCGGGGGTGGG + Exonic
1006686325 6:35837665-35837687 GCTACTCCGAAAGCTGGGGTGGG - Intronic
1006836021 6:36999265-36999287 GGCCTTCCAAAAGCAGGGGGTGG + Intergenic
1008278845 6:49572131-49572153 GCCCTTCGGAAAGCCGAGGCGGG + Intergenic
1017988548 6:159466267-159466289 GCCCATTCTAAAGCCGGGGTTGG - Intergenic
1019117144 6:169774409-169774431 GCCCTTACGAAGGTGGAGGTGGG + Intronic
1019420371 7:947998-948020 GCCCCTCCGGAAGAGGGAGTGGG - Intronic
1025616074 7:63118170-63118192 GCACTTCGGAAAGCTGAGGTGGG - Intergenic
1026820933 7:73548181-73548203 GCACTTCGGAAGGCGGAGGTGGG + Intronic
1029711201 7:102300930-102300952 GCCCTTGCGAACGCGGGCCTTGG - Exonic
1039885388 8:41651314-41651336 TCCCTTCCGCATGCGGGGATGGG + Intergenic
1040011073 8:42661619-42661641 GCCCTTCAGAAGATGGGGGTGGG - Intergenic
1042591385 8:70402496-70402518 CCTCTTCCGAGACCGGGGGTGGG - Intronic
1049746459 8:144265263-144265285 GCGCCTCCGAGGGCGGGGGTGGG - Intronic
1058710215 9:107672616-107672638 GCACTTCGGAAAGTGGAGGTGGG + Intergenic
1187920872 X:24200044-24200066 GGCCTTCAGAAAGAGGGGATGGG + Intronic
1189160388 X:38804113-38804135 GCCCTTTCTACAGCGGGGGCGGG - Exonic
1196667462 X:118331571-118331593 ACAGTTCCAAAAGCGGGGGTTGG + Intergenic