ID: 1064255846

View in Genome Browser
Species Human (GRCh38)
Location 10:13742267-13742289
Sequence TGCCCTTCCGAAAGCGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255846_1064255854 0 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data
1064255846_1064255859 14 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255846_1064255853 -9 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255853 10:13742281-13742303 GGAAGGGCAGAGCCAACCTGGGG No data
1064255846_1064255855 1 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data
1064255846_1064255858 8 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255846_1064255852 -10 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255852 10:13742280-13742302 CGGAAGGGCAGAGCCAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255846 Original CRISPR TGCCCTTCCGAAAGCGGGGG TGG (reversed) Intronic
908746125 1:67378229-67378251 TGACCTTTCAAAAGCTGGGGAGG - Intronic
1062998568 10:1891968-1891990 TGCCCATCCGAGAGTGGAGGAGG - Intergenic
1064033005 10:11894796-11894818 TGTCCTCCGGAAAGCGGGGGAGG + Intergenic
1064255846 10:13742267-13742289 TGCCCTTCCGAAAGCGGGGGTGG - Intronic
1065204296 10:23343285-23343307 TGCCCTTCTAAAAGCAGGGTGGG + Intronic
1069629503 10:69889166-69889188 TGCCCTTCAGAGAGCAGGGGTGG - Intronic
1073984018 10:109187331-109187353 TGCCCTCCCTTAAGTGGGGGAGG - Intergenic
1075797262 10:125129564-125129586 TGTCCTGCCGAACCCGGGGGTGG + Intronic
1080038113 11:27730345-27730367 AGCCCACCCGAAAGCAGGGGAGG - Intergenic
1083911614 11:65713231-65713253 TGTCCTTCAGAAGGCGAGGGTGG + Intronic
1096385978 12:51195835-51195857 GGCGCTTCCTAAAGTGGGGGAGG - Intronic
1100831041 12:98516474-98516496 TGCCCTTTCGAAAGCTCTGGAGG + Intronic
1106364369 13:29063939-29063961 TGCCCTTCAGACAGCAGGAGGGG + Intronic
1107770599 13:43785759-43785781 CCCCCTTCCGAAAGAGGGCGGGG + Intronic
1116430124 14:44836269-44836291 TGCCCTTCCCAGAAGGGGGGAGG + Intergenic
1120179148 14:81325367-81325389 TTCCCTTCCCAAAGAGGGGAAGG + Intronic
1122156472 14:99753229-99753251 TGCCCCTCGGAAAGCAGGTGCGG - Intronic
1124366173 15:29072878-29072900 TGCCCTTCCTAGAGCTGAGGTGG - Intronic
1129154707 15:73710556-73710578 TGCCCTTCCTTCTGCGGGGGTGG - Intronic
1131184735 15:90265003-90265025 TGCCCTTTGGAAACCTGGGGAGG - Intronic
1133000697 16:2850074-2850096 TGCCCTCCCCAAACCGGGGGGGG - Intergenic
1135212466 16:20535195-20535217 TGCCCTCCCTAATGTGGGGGTGG + Intergenic
1135557915 16:23452773-23452795 TGCCCAGCCGAGAGCAGGGGAGG + Intronic
1141907132 16:87034151-87034173 TATCCTTCCAGAAGCGGGGGAGG + Intergenic
1142127161 16:88415877-88415899 TGTCCTTCCTCAAGCTGGGGCGG + Intergenic
1146624249 17:34423965-34423987 TGCCCTTCCTGAAGGAGGGGCGG - Intergenic
1150009683 17:61492276-61492298 TGCCCTTCCATAAGAGGGGAAGG - Intergenic
1150124612 17:62628071-62628093 CGCTTTTCTGAAAGCGGGGGAGG + Intronic
1152096195 17:78273084-78273106 TGCCCTTCAGACAGCAGGAGGGG + Intergenic
1167741980 19:51329314-51329336 TGCCCTTTCGACAGGGGGAGGGG - Exonic
937425297 2:121794047-121794069 AGCACTTCAGAAGGCGGGGGCGG - Intergenic
940209740 2:151244271-151244293 TGCCCTCTCAAAAGCTGGGGTGG + Intergenic
1170826375 20:19799677-19799699 AGCCCTTCAGAACGCTGGGGAGG + Intergenic
1173586691 20:44187716-44187738 TGTGCTTCCGAAAGCAGAGGAGG + Intergenic
1177834016 21:26170417-26170439 TGGACGTCCGCAAGCGGGGGCGG + Intronic
1179968320 21:44819018-44819040 AGCCCGGCCGAAGGCGGGGGAGG + Intergenic
1181236683 22:21451205-21451227 TGCCCTTCCCAGAAGGGGGGAGG + Exonic
1183152321 22:36047531-36047553 TTCCATTCCTAAAGTGGGGGTGG - Intergenic
1184421305 22:44384378-44384400 AGCCATGCCGAAAGCTGGGGAGG + Intergenic
963425915 3:145123191-145123213 TGGCCTTACGAAAGAGGAGGGGG - Intergenic
969290471 4:6235820-6235842 TGCCGTTCCTAGAGAGGGGGTGG - Intergenic
975310357 4:72897570-72897592 TGCCCTACAGAAAGAGAGGGAGG + Intergenic
978318919 4:107471841-107471863 TGCCCTTCCAAAAACAGAGGAGG + Intergenic
980202247 4:129670765-129670787 TGCACTTCCAACAGCTGGGGTGG + Intergenic
981931885 4:150198914-150198936 TGCCCTACAGAAAGTGGGGGGGG - Intronic
988629063 5:32909770-32909792 TGCCCCTCCAAGAGAGGGGGCGG - Intergenic
992866343 5:80960573-80960595 CGGCCTCCCGAAAGCGGGCGGGG + Intergenic
994994516 5:107042930-107042952 TGCCCTGCCAGAAGCTGGGGAGG + Intergenic
995298089 5:110542800-110542822 TGCCATGCAGAAAGCGAGGGGGG - Intronic
999393545 5:151212051-151212073 TTCCCTTCCAAAAGAGGGGTGGG + Intronic
1002607215 5:180390473-180390495 TCCCCATCCGAAAGCTGGTGAGG - Intergenic
1004427727 6:15517524-15517546 AGCCCTTGGGAAAGCCGGGGGGG - Intronic
1008278844 6:49572130-49572152 AGCCCTTCGGAAAGCCGAGGCGG + Intergenic
1010414835 6:75601701-75601723 TACCCTGCCGAAAGCCCGGGCGG + Intronic
1018972261 6:168537853-168537875 TGCCCCTCCGAGGGCAGGGGAGG - Intronic
1021783756 7:24132844-24132866 TGCCCTTCCCAAAGCAGAAGGGG - Intergenic
1024715158 7:52071250-52071272 TGCCCTTCCCAATGTGGGTGGGG + Intergenic
1028086786 7:86645379-86645401 TGCCCTCCCGCAAGCAGGGTTGG + Intronic
1039885387 8:41651313-41651335 TTCCCTTCCGCATGCGGGGATGG + Intergenic
1040011074 8:42661620-42661642 TGCCCTTCAGAAGATGGGGGTGG - Intergenic
1043517101 8:81004965-81004987 TTCCATTCAGAAAGTGGGGGAGG - Intronic
1187441120 X:19321136-19321158 TGCCCTTCATAAAGTGGGTGGGG - Intergenic
1189160389 X:38804114-38804136 GGCCCTTTCTACAGCGGGGGCGG - Exonic