ID: 1064255847

View in Genome Browser
Species Human (GRCh38)
Location 10:13742270-13742292
Sequence CTCTGCCCTTCCGAAAGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255847_1064255858 5 Left 1064255847 10:13742270-13742292 CCCCCGCTTTCGGAAGGGCAGAG 0: 1
1: 0
2: 0
3: 22
4: 88
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255847_1064255855 -2 Left 1064255847 10:13742270-13742292 CCCCCGCTTTCGGAAGGGCAGAG 0: 1
1: 0
2: 0
3: 22
4: 88
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data
1064255847_1064255859 11 Left 1064255847 10:13742270-13742292 CCCCCGCTTTCGGAAGGGCAGAG 0: 1
1: 0
2: 0
3: 22
4: 88
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255847_1064255854 -3 Left 1064255847 10:13742270-13742292 CCCCCGCTTTCGGAAGGGCAGAG 0: 1
1: 0
2: 0
3: 22
4: 88
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255847 Original CRISPR CTCTGCCCTTCCGAAAGCGG GGG (reversed) Intronic
902198138 1:14813578-14813600 CTCTGCCATTCAGGCAGCGGTGG - Intronic
902585920 1:17438619-17438641 CTCTGCCCTCCCCAAAGTGGCGG + Intronic
903219297 1:21860054-21860076 CTCTGCTCTCCCAAAAGCTGGGG + Intronic
903877620 1:26486307-26486329 CTTAGCCCTTCAGAAAGAGGTGG - Intergenic
905265277 1:36749152-36749174 CTCTGCCAATCTGAAAGAGGGGG + Intergenic
909667654 1:78153778-78153800 CTCTGCCTTTGGAAAAGCGGAGG - Intergenic
912608793 1:111021320-111021342 CTCAGCCCTTCAGAAGGCTGAGG + Intergenic
923342658 1:233021148-233021170 TTCTGCCCTTCAGCAAGGGGTGG - Intronic
924718095 1:246597384-246597406 TTCTTCCCTTCCCCAAGCGGTGG + Intronic
1064255847 10:13742270-13742292 CTCTGCCCTTCCGAAAGCGGGGG - Intronic
1066370267 10:34814399-34814421 GACTGCCCTTCCGACAGAGGCGG - Intronic
1069739875 10:70680600-70680622 CTCTGCCCTTCCTACAGATGAGG - Intronic
1071349693 10:84727659-84727681 CTATGCCCTTCCCCAAGAGGTGG - Intergenic
1072401836 10:95110874-95110896 CTATGCCCTTCCCACAGAGGTGG + Intergenic
1072594605 10:96859803-96859825 CTCTTGGCTTCCGAAAGTGGTGG + Intronic
1073998095 10:109339222-109339244 CTATGCCCTTCCCACAGAGGTGG + Intergenic
1074470116 10:113719424-113719446 ATTTGGCCTTCCGAAAGTGGAGG + Intronic
1088447876 11:109951738-109951760 CTCTCCCCTTCCGAATGTTGGGG - Intergenic
1089152518 11:116374811-116374833 CTCTGCCCTTCAGAAAAGGAAGG + Intergenic
1094338935 12:29389401-29389423 CTCTGCCCTGCAGATACCGGAGG + Intergenic
1096948954 12:55443852-55443874 CTCTGCTCTTCTGAAATCAGAGG + Intergenic
1097210904 12:57368873-57368895 CTCTGCAGTTCCAAAAGTGGGGG + Intronic
1103898744 12:124292274-124292296 CTCTGCCCTTCCTACAGCGCTGG + Intronic
1106400896 13:29428926-29428948 CTCTGCCCTTGCAAAGGAGGAGG - Intronic
1114192987 14:20454763-20454785 CTCTGCGCTCCGGAAAGCTGCGG - Exonic
1116792765 14:49357122-49357144 CTATGCCCTTCCCACAGAGGTGG - Intergenic
1122263066 14:100534197-100534219 CGCTGCCCTGCCGAGAGCTGAGG + Intergenic
1122280315 14:100618402-100618424 CTCTGCCCTTCTGAAAGACGAGG + Intergenic
1123855946 15:24411823-24411845 GTCTGTGCTTCCGAAAGTGGTGG + Intergenic
1126606964 15:50487629-50487651 CTCTGCCCTTCAGGAAGCAAGGG + Intronic
1128357639 15:66939469-66939491 CTCTGCCATTCAGAACACGGAGG - Intergenic
1133209291 16:4254102-4254124 CCCAGCCCCTGCGAAAGCGGAGG - Intergenic
1135557914 16:23452770-23452792 CTCTGCCCAGCCGAGAGCAGGGG + Intronic
1139514825 16:67446800-67446822 CTCTTCCCGTCCGAAAGGGAGGG - Intronic
1146624250 17:34423968-34423990 CTCTGCCCTTCCTGAAGGAGGGG - Intergenic
1150124610 17:62628068-62628090 CTCCGCTTTTCTGAAAGCGGGGG + Intronic
1152037068 17:77880125-77880147 TTCTGCCCTTCTGAAAGCAGAGG + Intergenic
1153804850 18:8703288-8703310 CTCTGCCCTTCCGTGGGAGGGGG - Intergenic
1154386637 18:13898283-13898305 CTCTGCCTTTCGGAAAGAGACGG + Intronic
1156443820 18:37219414-37219436 CTCTGCCCTTCCCCCAGAGGTGG + Intronic
1166023305 19:40053888-40053910 CCCAGCACTTTCGAAAGCGGAGG + Intronic
1167209520 19:48124762-48124784 CTCAGCGCTTTGGAAAGCGGAGG + Intronic
925885068 2:8388460-8388482 CTCTGTCCTTCAGAAAGGGCAGG - Intergenic
927773307 2:25882491-25882513 CTATGCCCTACCCAAAACGGAGG - Intergenic
938578295 2:132623544-132623566 CCCTGCCCTTCAAAAAGCGAAGG + Intronic
939019912 2:136946571-136946593 CTATGCCCTGCCGCAAGAGGTGG + Intronic
939795766 2:146642357-146642379 CTCTGCCCTGCCAACAGAGGTGG - Intergenic
940209739 2:151244268-151244290 CTCTGCCCTCTCAAAAGCTGGGG + Intergenic
1172581301 20:36050818-36050840 CTCTGCCCTGCAGATAACGGAGG - Intergenic
1175830813 20:61964869-61964891 CTCTGCTCTTCCTAAAGCCAAGG - Intronic
1183218370 22:36495934-36495956 CTCTGCCCTTCCCCAACCTGTGG - Intronic
1185197588 22:49481992-49482014 CTCTGTCCTGCCCACAGCGGAGG - Intronic
950521547 3:13500697-13500719 CTCTGCCCTTCCGCAGGGGGTGG + Exonic
953027527 3:39153554-39153576 CTCTGCGCGTCCGGCAGCGGCGG + Exonic
956477371 3:69636933-69636955 CTCTGCCCTGCCCACAGAGGTGG + Intergenic
957311979 3:78532274-78532296 CTCGGCACTTCAGAAGGCGGAGG + Intergenic
958081143 3:88747436-88747458 CTATGCCCTGCCCAAAGAGGTGG - Intergenic
968451042 4:676179-676201 GTCTGCCCTGGCGGAAGCGGGGG - Intronic
968647405 4:1747628-1747650 CTCTGCCCTTCCCACAGCTCAGG + Intergenic
972557308 4:40194054-40194076 GTCTCCCCTTCAGAAAGCAGAGG - Intronic
972593081 4:40506525-40506547 CTCTGCCCTTCCCAGTGCAGTGG - Intronic
977399196 4:96510170-96510192 CTCTGCCCTTTGGAAAGGGGAGG + Intergenic
987709897 5:21493015-21493037 CTCTGCCCATCCGAAGGCTGTGG - Intergenic
987989400 5:25190876-25190898 CTCTGCCCTGCAGACACCGGAGG - Intergenic
988749715 5:34181148-34181170 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
989621676 5:43390480-43390502 CTTTGCCCTTCCCAAAGCAAAGG - Intronic
991630644 5:68653507-68653529 CTCTTCCCTTCAGCAAGAGGAGG + Intergenic
991737974 5:69644352-69644374 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
991760220 5:69912072-69912094 CTCTGCCCATCCGAAGGCTGTGG - Intergenic
991787112 5:70206028-70206050 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
991789550 5:70224078-70224100 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
991814299 5:70499188-70499210 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
991817434 5:70520480-70520502 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
991839451 5:70787123-70787145 CTCTGCCCATCCGAAGGCTGTGG - Intergenic
991879558 5:71206418-71206440 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
991881998 5:71224447-71224469 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
993550045 5:89262106-89262128 CTCTGCCCTTGCCAAATCTGAGG + Intergenic
994460511 5:100064415-100064437 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
994484658 5:100377826-100377848 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
996262444 5:121490387-121490409 ATCTGCCCTTCCTCTAGCGGAGG - Intergenic
1000520215 5:162285557-162285579 CTCTGCCCCTCACAAAGAGGTGG + Intergenic
1005512310 6:26521837-26521859 CTCTGCCCTGCAGATACCGGAGG + Intergenic
1005547783 6:26887491-26887513 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
1008278842 6:49572127-49572149 CCCAGCCCTTCGGAAAGCCGAGG + Intergenic
1009018546 6:57928572-57928594 CTCTGCCCATCCGAAGGCTGTGG + Intergenic
1016005979 6:139090013-139090035 CTATGCCCTTCCTACAGAGGTGG + Intergenic
1018444584 6:163843700-163843722 CTGTGCCCTTCAGAAAAGGGGGG - Intergenic
1019177563 6:170167944-170167966 CTCTGCCCTTTGGAAAGGAGGGG + Intergenic
1019316640 7:390064-390086 CTCTGGCCTTCCCACAGCCGAGG + Intergenic
1020076862 7:5263932-5263954 CTGAGCCCTTCCCAAAGCTGAGG + Intergenic
1024783975 7:52885454-52885476 CTCTGCCATTCACAAAGCTGTGG + Intergenic
1025202238 7:56969662-56969684 CTGAGCCCTTCCCAAAGCTGAGG - Intergenic
1025669709 7:63607265-63607287 CTGAGCCCTTCCCAAAGCTGAGG + Intergenic
1025732201 7:64116837-64116859 CTCTGCCCATCCAAAGGCTGTGG - Intronic
1025927667 7:65972540-65972562 CTCTGCCTATCCGAAGGCTGTGG + Intronic
1026987123 7:74561585-74561607 CTCTGCCCCTCCGAGAGCTCCGG - Intronic
1038226186 8:25660383-25660405 CTGTGCCCTTCCCCAAGAGGTGG + Intergenic
1044719213 8:95129594-95129616 CTCTGCCCTTCACATAGCTGCGG - Intergenic
1046879200 8:119289909-119289931 CTATGCCCTTCCCACAGAGGTGG + Intergenic
1047572111 8:126110384-126110406 CTCTGCCCTTCCCAGAGAAGGGG - Intergenic
1048578205 8:135709545-135709567 CTCTGCCCTTCAGTAAGGAGAGG - Intergenic
1049495140 8:142926519-142926541 CTGTGCGTTTCTGAAAGCGGAGG - Intergenic
1053321002 9:37098747-37098769 CTCAGCCCCTCTGAAAGAGGTGG - Intergenic
1056375987 9:86011472-86011494 CTCTGCTCCTCCGAATGCTGAGG - Intronic
1057855315 9:98596776-98596798 CTCTGCCCCTCCAAACGCGGAGG - Intronic
1061311151 9:129763546-129763568 CACTGCCCTTCAGAAATTGGAGG + Intergenic
1061672193 9:132194903-132194925 CTCAGCCCCTCAGAAGGCGGTGG + Intronic
1187464948 X:19518887-19518909 CTTTGCCCTTCTGAAGGCTGTGG - Intergenic
1191087692 X:56587109-56587131 CTGTGCCCTTCCCACAGAGGTGG + Intergenic
1191092149 X:56635154-56635176 CTGTGCCCTTCCCACAGAGGTGG + Intergenic
1201938730 Y:19435440-19435462 CTATGCCCTGCCCAAAGAGGTGG - Intergenic