ID: 1064255848

View in Genome Browser
Species Human (GRCh38)
Location 10:13742271-13742293
Sequence GCTCTGCCCTTCCGAAAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255848_1064255855 -3 Left 1064255848 10:13742271-13742293 CCCCGCTTTCGGAAGGGCAGAGC 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data
1064255848_1064255859 10 Left 1064255848 10:13742271-13742293 CCCCGCTTTCGGAAGGGCAGAGC 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255848_1064255854 -4 Left 1064255848 10:13742271-13742293 CCCCGCTTTCGGAAGGGCAGAGC 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data
1064255848_1064255858 4 Left 1064255848 10:13742271-13742293 CCCCGCTTTCGGAAGGGCAGAGC 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255848 Original CRISPR GCTCTGCCCTTCCGAAAGCG GGG (reversed) Intronic
901851650 1:12019767-12019789 GCTTTTCCCTTTCCAAAGCGCGG + Intronic
908803713 1:67907921-67907943 GCTCTGCCCATCCGAGTGGGAGG + Intergenic
918256499 1:182753356-182753378 CCTCTGCCCCTCAGAAAGAGAGG - Intergenic
918375932 1:183909035-183909057 GCTATGCCCTTCACAAAGTGTGG + Intronic
1064255848 10:13742271-13742293 GCTCTGCCCTTCCGAAAGCGGGG - Intronic
1070660707 10:78303428-78303450 CCTCTGCCCTTCGGAAACCAGGG - Intergenic
1073136033 10:101220980-101221002 GCTCAGCCCTGCCCAAAGTGGGG - Intergenic
1083263586 11:61536008-61536030 ACTCTCCCCTTCCCAAAGCTTGG - Intronic
1084575757 11:69986912-69986934 GCTCTGCCCTTCTGAAGCCCTGG + Intergenic
1085049900 11:73375112-73375134 GCTCTGGCCTTCCGTAGGCTGGG + Intergenic
1087065122 11:94020916-94020938 CCTCTGCCCTCCCGACAGAGAGG + Intergenic
1089822190 11:121238615-121238637 GCTCTCCCCTCCCCAAAGCAGGG - Intergenic
1091281689 11:134385196-134385218 CCACTGCCCTTCCGCAAGAGAGG - Intronic
1096271088 12:50167028-50167050 CCTCGGCCCTTCCCACAGCGGGG + Intronic
1096611565 12:52805451-52805473 GTTCTGCCTTTGGGAAAGCGGGG - Intergenic
1098959939 12:76729311-76729333 TCTCTGCCCTACAGAAAGCTGGG - Intergenic
1102978341 12:117222574-117222596 GCTCTGTACTTCAGAAAGCATGG - Intronic
1107271614 13:38625192-38625214 GCTCTCTCCTGCAGAAAGCGGGG - Intergenic
1113373731 13:109744956-109744978 GCCCTGCCCTTCAGAGAGCCAGG - Intergenic
1122908790 14:104816189-104816211 GCTCTCCCCTCCCAAAAGCGCGG + Intergenic
1125616717 15:41020848-41020870 GTTCTCCCCTTGCCAAAGCGAGG + Intronic
1126606963 15:50487628-50487650 TCTCTGCCCTTCAGGAAGCAAGG + Intronic
1129821579 15:78605689-78605711 TCTCTGTCCTTCTGAAAGGGAGG - Intronic
1138034631 16:53591961-53591983 GCTCTGCCAATCTGAAAGCAAGG - Intergenic
1139514826 16:67446801-67446823 CCTCTTCCCGTCCGAAAGGGAGG - Intronic
1142769164 17:2084282-2084304 GCTCTGCCCTGCCTGAAGCCTGG + Intronic
1144453150 17:15397801-15397823 GCTCTGCCCCTCTGAATGTGAGG + Intergenic
1151759220 17:76091072-76091094 GCTCTGCCCTGCCAAGTGCGTGG + Intronic
1152147451 17:78576935-78576957 TCTCTGCCCCTCCGGAAGCATGG - Intronic
1153804851 18:8703289-8703311 GCTCTGCCCTTCCGTGGGAGGGG - Intergenic
1160424875 18:78772920-78772942 GCTCACCCCATCCGAATGCGAGG + Intergenic
1161415543 19:4144831-4144853 GCTCTGCCCTTCTTAAAGAATGG - Intergenic
1168443461 19:56391795-56391817 ACTCTGCCCTTCCCCAAGAGAGG - Exonic
925909851 2:8566463-8566485 GCTCTGCCCTTCAGAAGTCAAGG - Intergenic
933403221 2:81825236-81825258 GCTCTGCTCTTCCCAAATCAAGG - Intergenic
934502105 2:94869826-94869848 GCTCTGCTCTGCCTAAAGAGAGG + Intergenic
939156291 2:138528193-138528215 GCTCTACCCTTCCCCAAGGGTGG - Intronic
940209738 2:151244267-151244289 GCTCTGCCCTCTCAAAAGCTGGG + Intergenic
943875449 2:193061627-193061649 GCTCTGCCGTTCTGAGATCGTGG - Intergenic
947333022 2:229050361-229050383 GCTCTGCCCATCCTAAATCAAGG + Intronic
1176285935 21:5019756-5019778 GCTCTGCCGTTTCGAGGGCGTGG - Intergenic
1179871246 21:44243719-44243741 GCTCTGCCGTTTCGAGGGCGTGG + Intergenic
1182681499 22:32083271-32083293 GCTCTGCCCTTCCAAACGGAGGG + Intronic
952106721 3:30078741-30078763 TCTCTGCCCTTTCAAAACCGTGG + Intergenic
952733215 3:36661820-36661842 GCCCTGCCCTTTGGAAAGGGTGG + Intergenic
954618088 3:51980524-51980546 GCCCTGCCCTTCCTGATGCGAGG + Exonic
964803559 3:160581313-160581335 GCACTGCCCTTCCCAAACTGGGG - Intergenic
969094091 4:4719083-4719105 GCTCTGCGCTTCTGCAAGCATGG + Intergenic
975144160 4:70949463-70949485 TGTCTGCCTTTCTGAAAGCGTGG + Intronic
975310355 4:72897566-72897588 GCTTTGCCCTACAGAAAGAGAGG + Intergenic
998040375 5:138947556-138947578 GCTCTGCCCTTCAGACAGGAAGG + Intronic
1003324978 6:5084709-5084731 GCTCTGCTCTTCCGAAAGCCGGG - Exonic
1004883582 6:20031802-20031824 CTTCTGACCTTCAGAAAGCGTGG + Intergenic
1007608018 6:43130259-43130281 GCTCTGACCATCAGAAAGGGGGG - Exonic
1010272003 6:73925825-73925847 CCTCTGCCCTGCCGCAACCGCGG - Intergenic
1018061407 6:160092608-160092630 GCTCTGCCCTCCCGAAGGAATGG - Intronic
1019177562 6:170167943-170167965 GCTCTGCCCTTTGGAAAGGAGGG + Intergenic
1022469604 7:30674253-30674275 GCTCTGCCCTCCCCAGAGAGGGG + Intronic
1022786302 7:33640927-33640949 GCTCTGCCCATCCCAGAGAGAGG - Intergenic
1031090655 7:117349729-117349751 TCTCTGCCTTTCAGCAAGCGGGG - Intergenic
1042050786 8:64703628-64703650 GCTCTGTCATTCAGAAAGGGAGG + Intronic
1042113402 8:65405609-65405631 GTTCTGCTTTTCTGAAAGCGCGG + Intergenic