ID: 1064255849

View in Genome Browser
Species Human (GRCh38)
Location 10:13742272-13742294
Sequence GGCTCTGCCCTTCCGAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255849_1064255858 3 Left 1064255849 10:13742272-13742294 CCCGCTTTCGGAAGGGCAGAGCC 0: 1
1: 0
2: 1
3: 3
4: 112
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255849_1064255854 -5 Left 1064255849 10:13742272-13742294 CCCGCTTTCGGAAGGGCAGAGCC 0: 1
1: 0
2: 1
3: 3
4: 112
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data
1064255849_1064255859 9 Left 1064255849 10:13742272-13742294 CCCGCTTTCGGAAGGGCAGAGCC 0: 1
1: 0
2: 1
3: 3
4: 112
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255849_1064255855 -4 Left 1064255849 10:13742272-13742294 CCCGCTTTCGGAAGGGCAGAGCC 0: 1
1: 0
2: 1
3: 3
4: 112
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255849 Original CRISPR GGCTCTGCCCTTCCGAAAGC GGG (reversed) Intronic
900097260 1:944995-945017 GGCTCTGCCCTCCCGCCAGATGG + Intronic
900628490 1:3621022-3621044 GGCTCTGCCTTTTAGATAGCAGG - Intergenic
902648267 1:17819218-17819240 GGCTCTGCCCTGCTGAGAGCAGG - Intronic
906057280 1:42927104-42927126 GGCTCCCCCCTGCCGGAAGCCGG + Exonic
906475798 1:46168582-46168604 GGCTCTGCCCTGCCCAAGGTTGG - Intronic
918144146 1:181741178-181741200 GGCTCTGTTCTTCCTAAAGATGG - Intronic
919980539 1:202640261-202640283 GGCTCTGCCTTTGCCAAGGCTGG - Intronic
1064255849 10:13742272-13742294 GGCTCTGCCCTTCCGAAAGCGGG - Intronic
1069220777 10:65880474-65880496 TGATCTGCCCTTCCCAATGCAGG + Intergenic
1069950205 10:72013431-72013453 GGGGCTGCCCTTCAGAGAGCTGG + Exonic
1070660709 10:78303429-78303451 GCCTCTGCCCTTCGGAAACCAGG - Intergenic
1071629349 10:87205451-87205473 GACTCTGCACTTACGACAGCAGG + Intergenic
1071983106 10:91023516-91023538 GGCTCTGCCCCAAAGAAAGCAGG - Intergenic
1073136034 10:101220981-101221003 GGCTCAGCCCTGCCCAAAGTGGG - Intergenic
1074465659 10:113679411-113679433 GGCTCTCCCCTAGCGAAACCTGG - Intronic
1075667994 10:124244480-124244502 GACTCTGCCCTGCAGAAGGCCGG - Intergenic
1075679721 10:124323462-124323484 GCCTCTGCCCTGCAGAAAGGGGG + Intergenic
1081814270 11:45929762-45929784 GGGGCTGCCCTCCAGAAAGCCGG - Intronic
1083143106 11:60737895-60737917 GACTCTGCTCTTCCTAAAGGGGG - Intronic
1085049899 11:73375111-73375133 TGCTCTGGCCTTCCGTAGGCTGG + Intergenic
1089822191 11:121238616-121238638 TGCTCTCCCCTCCCCAAAGCAGG - Intergenic
1090435633 11:126684269-126684291 ATTTCTGCCCTTCTGAAAGCGGG + Intronic
1090799632 11:130162180-130162202 GGCTGTCCCCTTCCCAAGGCTGG + Intronic
1092447655 12:8572550-8572572 GGGTTTGCTCTTCTGAAAGCTGG + Intergenic
1098959940 12:76729312-76729334 GTCTCTGCCCTACAGAAAGCTGG - Intergenic
1100281279 12:93120613-93120635 GGCTCTACACTTCCGTAACCTGG - Intergenic
1100817653 12:98401401-98401423 GGCTCTGCCCTTGCGAGGGGAGG - Intergenic
1102797323 12:115700163-115700185 GGCTCAGCCCTTCACAGAGCTGG + Intergenic
1104050188 12:125189547-125189569 GGCGCTGCCCTTCAGAGAGGTGG + Intronic
1116898628 14:50340964-50340986 GGCTCTGCCCTGCCCCAACCTGG + Intronic
1125489698 15:40137320-40137342 GGCTCTGCCCTAGGGAGAGCAGG - Intergenic
1127626930 15:60788772-60788794 GGCTCTGACCCTCAGACAGCAGG - Intronic
1132895287 16:2226225-2226247 GGCACTGCCCTTCTCCAAGCTGG - Intronic
1136315275 16:29451247-29451269 GGATCTGCCCTTCAGTGAGCTGG - Intronic
1136429852 16:30190589-30190611 GGATCTGCCCTTCAGTGAGCTGG - Intergenic
1137268005 16:46884489-46884511 GGCGCAGCCTTTGCGAAAGCCGG + Intronic
1141593062 16:85081454-85081476 TGCTCTCCTCTTCCGAAACCGGG - Intronic
1141987205 16:87587786-87587808 GGCCCTGCCCTTCCAGAAGGAGG - Intergenic
1142123338 16:88397958-88397980 GGTTCTGCCCTGCCCAGAGCCGG + Intergenic
1142764435 17:2057503-2057525 GCCGCTGCCCTTCCAGAAGCTGG + Exonic
1147325480 17:39667716-39667738 GGCACTGCCCGTCCGATGGCAGG - Intergenic
1150218626 17:63483754-63483776 GCCTCTGCCCTGCAGGAAGCTGG + Intergenic
1150449447 17:65254057-65254079 GGCTCTGATCTTCCCAGAGCTGG - Intergenic
1152742076 17:82022817-82022839 GGCCCTCACCTTCCGGAAGCCGG + Exonic
1152812517 17:82388757-82388779 GCCTCGGCCCTGCAGAAAGCCGG + Intergenic
1160070097 18:75621067-75621089 GGCTCAGTCCTTCCCTAAGCTGG + Intergenic
1162475507 19:10897111-10897133 GTCTCTGCGCTTCCTAGAGCAGG - Intronic
1165102100 19:33444971-33444993 AGCCCAGCCCTTCAGAAAGCTGG + Intronic
1168508489 19:56955765-56955787 GAGTCTGCCCTTCCCAAGGCAGG + Intergenic
926558934 2:14393905-14393927 ACTTCTGCCCTTCCAAAAGCAGG - Intergenic
929071823 2:38038774-38038796 GTCTCTGCCCTTACTAATGCCGG - Intronic
930140863 2:47950191-47950213 GGCTTTTCCCTTCCGAAACATGG + Intergenic
930481128 2:51949002-51949024 CTATCTGCCCTTCTGAAAGCAGG - Intergenic
932489675 2:72112828-72112850 GGCACTCCCCTTGAGAAAGCAGG + Intergenic
940209737 2:151244266-151244288 AGCTCTGCCCTCTCAAAAGCTGG + Intergenic
943756591 2:191563596-191563618 GGCTCTTCCCAGCCAAAAGCAGG + Intergenic
948575551 2:238947269-238947291 GGCTCTGCCCTCCTGAGAGGGGG - Intergenic
948575595 2:238947433-238947455 GGCTCTGCCCTCCTGAGAGGGGG - Intergenic
1173897647 20:46563001-46563023 GGCTGGGCCCTGCTGAAAGCTGG + Intronic
1175972113 20:62691954-62691976 GGCCCTGCCTTTCCTCAAGCTGG - Intergenic
1180089830 21:45528225-45528247 GGCTCTGCCCTGCCCAGCGCTGG - Intronic
1181528639 22:23503522-23503544 GGCACAGCCCTGCCCAAAGCTGG - Intergenic
1182102761 22:27669650-27669672 GGCTCTGCCCTTTTGAGAGGAGG - Intergenic
1182681498 22:32083270-32083292 TGCTCTGCCCTTCCAAACGGAGG + Intronic
1183748857 22:39707741-39707763 GGCTCGGCCCATCCCAGAGCTGG - Intergenic
1184897909 22:47422890-47422912 GGCTGTGCCCCACTGAAAGCAGG + Intergenic
958729891 3:97950282-97950304 AGCTCTGCCTTTTGGAAAGCAGG + Intronic
961430117 3:126875343-126875365 GTCTCTGCTCTTCAGAAGGCAGG - Intronic
964441337 3:156714360-156714382 GGTTCTTCCCTTCGGAAAGATGG - Intergenic
969449935 4:7267310-7267332 GGCTCTGCCCTCAAGTAAGCAGG - Intronic
969452988 4:7285618-7285640 AGCTCTGCCCTCCAGACAGCTGG + Intronic
972290499 4:37686327-37686349 GGCTCTGCCTTCCCGAGCGCGGG - Exonic
974410682 4:61538398-61538420 GACTATGCCCTTCTGATAGCAGG + Intronic
974717376 4:65685893-65685915 TGCCCTTCCCTTCCCAAAGCAGG + Intergenic
978118929 4:105054849-105054871 GGCAATACCCTTCCGGAAGCAGG + Intergenic
980749379 4:137069602-137069624 GGCTGTGCACTTCCGTCAGCTGG + Intergenic
984938524 4:184911008-184911030 TGCTCTCCCCTCCCCAAAGCAGG + Intergenic
985809599 5:2073304-2073326 GGCTCTGCCATTCTGGAATCCGG - Intergenic
987876674 5:23689255-23689277 TGCTCTCCCCTCCCCAAAGCAGG - Intergenic
987891033 5:23879128-23879150 GGCTCTGCCATTCTGCAATCTGG - Intergenic
987956625 5:24749426-24749448 TGCTCTCCCCTCCCCAAAGCAGG + Intergenic
991025053 5:62020150-62020172 GGCTTTGTCCTTACGAAACCTGG + Intergenic
994961988 5:106616976-106616998 AGCTATGCCCTTACGAAAACTGG + Intergenic
995371833 5:111427304-111427326 GGCCCTTCCCTTCCGTTAGCAGG - Intronic
1000293391 5:159891815-159891837 GGCTCTCCCCTACCAAAATCAGG - Intergenic
1001691193 5:173633774-173633796 GGCTCTGACCTGCCTGAAGCAGG - Intergenic
1001720820 5:173855649-173855671 GTCTCTGCCCATCCCAAGGCTGG - Intergenic
1003324979 6:5084710-5084732 CGCTCTGCTCTTCCGAAAGCCGG - Exonic
1004251043 6:14023382-14023404 GGCTCTGCCATTCTGAAGCCAGG - Intergenic
1006589762 6:35145925-35145947 GGCTCTGCTCTTCCGACCTCAGG + Intronic
1007144086 6:39609782-39609804 GGCTTTACCCTTAAGAAAGCTGG - Intronic
1007422952 6:41730488-41730510 GGCTCTCCCCATAAGAAAGCTGG + Intronic
1007692539 6:43712001-43712023 TGCTGTGCCCTTCCCAAGGCAGG + Intergenic
1008054029 6:46928184-46928206 GGCTCTGAACTTCCACAAGCTGG - Intronic
1013184657 6:107746988-107747010 GGCCCTGGCCTTGGGAAAGCTGG + Intronic
1014975687 6:127879766-127879788 GCCTCTGGCCTTCCGTGAGCTGG + Intronic
1019177561 6:170167942-170167964 AGCTCTGCCCTTTGGAAAGGAGG + Intergenic
1019427264 7:983532-983554 GGCTTTCCCCTCCCAAAAGCAGG - Intronic
1019565431 7:1676522-1676544 GGCTCTGCCCTTTCCAGAACTGG - Intergenic
1035358571 7:158295108-158295130 GGCTCTGACCCTCGGAAAGGCGG - Intronic
1036698256 8:10993540-10993562 TGCTCAGCCGTTCCAAAAGCAGG + Intronic
1040865780 8:52047803-52047825 GTCTGTGGCCTTCCAAAAGCTGG + Intergenic
1046131324 8:109972273-109972295 GGCTCTGCGCATGCTAAAGCTGG - Exonic
1046427445 8:114073494-114073516 GGCTCTGCCTTTGAGGAAGCAGG - Intergenic
1048744277 8:137595948-137595970 GGCTCTGCACATCCCAATGCTGG - Intergenic
1048969447 8:139636592-139636614 CGCTCTGCCCTTCTGGAAGTTGG - Intronic
1049609820 8:143549698-143549720 TGCGCTGCCCTTCCGAACACCGG - Intergenic
1049880048 8:145055721-145055743 GGCTCTGCCTTTTAGATAGCAGG + Exonic
1057299065 9:93865953-93865975 GGCTCTGCGATTCAGACAGCGGG + Intergenic
1059230562 9:112717795-112717817 GGCTCTGCACATCCGTAGGCAGG - Intronic
1062397800 9:136359395-136359417 GGCCCTGCCCCTCCAGAAGCAGG - Exonic
1185764671 X:2715795-2715817 GGCTCTGCCTTTGTGAACGCTGG + Intronic
1187040647 X:15591792-15591814 GGCTCTGGGCTTGGGAAAGCTGG - Exonic
1190222654 X:48522222-48522244 GGCTCTGGCTTTCCAAACGCTGG + Intronic
1198310291 X:135422767-135422789 GGCTCTGCCCTTCAGATGTCAGG + Intergenic
1198431903 X:136575857-136575879 GGCATTGTCCTTCTGAAAGCTGG - Intergenic
1200171051 X:154075060-154075082 GCCTCTGCCCTTCTGCAATCTGG - Intronic