ID: 1064255850

View in Genome Browser
Species Human (GRCh38)
Location 10:13742273-13742295
Sequence TGGCTCTGCCCTTCCGAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255850_1064255858 2 Left 1064255850 10:13742273-13742295 CCGCTTTCGGAAGGGCAGAGCCA 0: 1
1: 0
2: 0
3: 2
4: 122
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255850_1064255855 -5 Left 1064255850 10:13742273-13742295 CCGCTTTCGGAAGGGCAGAGCCA 0: 1
1: 0
2: 0
3: 2
4: 122
Right 1064255855 10:13742291-13742313 AGCCAACCTGGGGAATCCCAGGG No data
1064255850_1064255859 8 Left 1064255850 10:13742273-13742295 CCGCTTTCGGAAGGGCAGAGCCA 0: 1
1: 0
2: 0
3: 2
4: 122
Right 1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG No data
1064255850_1064255854 -6 Left 1064255850 10:13742273-13742295 CCGCTTTCGGAAGGGCAGAGCCA 0: 1
1: 0
2: 0
3: 2
4: 122
Right 1064255854 10:13742290-13742312 GAGCCAACCTGGGGAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255850 Original CRISPR TGGCTCTGCCCTTCCGAAAG CGG (reversed) Intronic
900650429 1:3727608-3727630 TGGCTGTGCCCACCCGACAGTGG + Exonic
910262939 1:85308890-85308912 TTGCTCTGCCCTTCTGAACTGGG - Intergenic
918408515 1:184234831-184234853 TGGCTATGCCCTTCCCCCAGAGG + Intergenic
920817290 1:209346501-209346523 TGTCCCTGCCCTTCTGCAAGAGG - Intergenic
1063364302 10:5480565-5480587 TGACTCTGCCCTTCCCACTGAGG - Intergenic
1063567076 10:7180467-7180489 TGGCCCTGCCCTTCCCAGAAGGG + Intronic
1064255850 10:13742273-13742295 TGGCTCTGCCCTTCCGAAAGCGG - Intronic
1065847506 10:29758150-29758172 TGTCTCTGCCCTTCAGAAGCTGG - Intergenic
1065929019 10:30462824-30462846 TGCCTCTGCCCTTACCAGAGGGG - Intergenic
1073136035 10:101220982-101221004 GGGCTCAGCCCTGCCCAAAGTGG - Intergenic
1075679720 10:124323461-124323483 AGCCTCTGCCCTGCAGAAAGGGG + Intergenic
1082122189 11:48391465-48391487 TGGCTCTGCCCTGCCCCCAGAGG + Intergenic
1082556172 11:54565707-54565729 TGGCTCTGCCCTGCCCCCAGAGG + Intergenic
1083143107 11:60737896-60737918 GGACTCTGCTCTTCCTAAAGGGG - Intronic
1083731528 11:64654978-64655000 TGGCTTTGCCTTTCAGAGAGGGG + Intronic
1084109326 11:67003185-67003207 TGGCTCTGCCCTGGCACAAGAGG + Intergenic
1086747563 11:90449097-90449119 TGTCTCTGTCATTCCCAAAGAGG + Intergenic
1089680780 11:120117773-120117795 TGGTCCTGCCTTTCCCAAAGGGG + Intronic
1094213321 12:27915554-27915576 TGGCTCCATCCTTCCAAAAGTGG + Intergenic
1096293789 12:50365748-50365770 TGTCTCAGCTCTTCGGAAAGAGG - Intronic
1096962944 12:55598629-55598651 TGGCTATGCCCTTCCCCCAGAGG - Intergenic
1099240108 12:80128616-80128638 TGGCTATGCCCTGCCCACAGAGG + Intergenic
1101314066 12:103613263-103613285 TGGCTATGCCCTGCCCACAGAGG + Intronic
1104847310 12:131852958-131852980 TGGCTCTGCCCTGCACCAAGTGG + Intergenic
1104863621 12:131939404-131939426 TGGTTCTGACCTTCAGAAACGGG + Intronic
1107177392 13:37414926-37414948 TGGCTCCTCCCTTCCCAAATGGG + Intergenic
1108547958 13:51515276-51515298 TGGCTCTGCCCTGCCCCCAGAGG + Intergenic
1110654998 13:77987184-77987206 TGGATCTGCACATCCCAAAGAGG + Intergenic
1111947260 13:94678844-94678866 TGGCACTTCCCTTCAAAAAGTGG + Intergenic
1115176049 14:30562770-30562792 TGGCTCTGCCTTTTAGATAGCGG + Intronic
1122356095 14:101123886-101123908 TGGCTCTGCGCATCCTGAAGGGG - Intergenic
1128598227 15:68973163-68973185 AGGCTCTGCCCTTCCAATGGAGG + Intronic
1129237297 15:74231352-74231374 TGGCTCTGCCCTTGCTTATGGGG + Intergenic
1129540745 15:76345833-76345855 TGGCTCTGACCTTCCGGACCAGG - Intergenic
1137683891 16:50372819-50372841 TGGCTCTGCCCATCCCTCAGAGG - Intergenic
1137863197 16:51867698-51867720 TGCCGCTTCCTTTCCGAAAGGGG - Intergenic
1137907091 16:52333957-52333979 TGGCTATGCCCTGCCCTAAGAGG - Intergenic
1142267540 16:89071365-89071387 TGGTTCTGCCTTCCCCAAAGCGG - Intergenic
1142850797 17:2703860-2703882 TGGCTTTCCCCTTCCAGAAGGGG + Intronic
1146553280 17:33800510-33800532 TGGATCTGCTCCTCCGTAAGTGG - Intronic
1151799671 17:76370770-76370792 TGGCTTTGCCGTTCCTACAGTGG - Intronic
1152388000 17:79986657-79986679 TGGCTCTGCCCTTTAATAAGAGG - Intronic
1152618698 17:81350102-81350124 AGGCTCTGCCCATCCTAGAGAGG + Intergenic
1153804853 18:8703291-8703313 TAGCTCTGCCCTTCCGTGGGAGG - Intergenic
1154403493 18:14065537-14065559 TGGCTATGCCCTTCCCCCAGAGG - Intronic
1157189477 18:45568486-45568508 TGGCTCTGCCCATCACAATGAGG - Intronic
1160509198 18:79443843-79443865 TGGCACAGCCCTTCCCAGAGAGG - Intronic
1162043519 19:7984500-7984522 TGGCTCTGCCCTGCTGCCAGTGG - Intronic
1164098124 19:22030039-22030061 TGCCTGTGCCCTTCCTACAGCGG - Intergenic
1168132499 19:54330493-54330515 AGGCTCTGCCCTCAGGAAAGGGG - Intergenic
925069754 2:956680-956702 GGGCTGTGTCCTTCTGAAAGCGG - Intronic
927000773 2:18792192-18792214 TGGCCCTGCTCTTTGGAAAGAGG - Intergenic
929112723 2:38418948-38418970 TTGCTCTGACCTTCAGACAGGGG - Intergenic
929827846 2:45323514-45323536 TGGCTCTGCCCTGCTCCAAGGGG - Intergenic
937347253 2:121133662-121133684 TGGCTCTGCCCTGAGGAATGGGG + Intergenic
938987822 2:136596602-136596624 TGGCTATGCCCTGCCCCAAGAGG - Intergenic
945537792 2:211040652-211040674 TAGTTCTGCCCTTCAGAAGGTGG - Intergenic
948575552 2:238947270-238947292 GGGCTCTGCCCTCCTGAGAGGGG - Intergenic
948575596 2:238947434-238947456 GGGCTCTGCCCTCCTGAGAGGGG - Intergenic
1171140322 20:22735209-22735231 TGGCTCTGCCCTGCCCCTAGTGG - Intergenic
1175445697 20:59018103-59018125 TGGCTCTCCCCTTCCGAGCCAGG + Intergenic
1180148418 21:45934902-45934924 TGGCCCTGCCCTTCAGCCAGGGG + Intronic
1181235167 22:21444209-21444231 TGGTGCTGCCCTTCCTAGAGAGG + Intronic
1185273311 22:49938413-49938435 TGGCACTGCCCTTCCCTATGTGG - Intergenic
951461666 3:22957753-22957775 TTGCTCTGCCCAGCAGAAAGTGG - Intergenic
952605150 3:35137791-35137813 AGGCTCTGGCCTACCAAAAGTGG + Intergenic
964803561 3:160581315-160581337 TAGCACTGCCCTTCCCAAACTGG - Intergenic
969610990 4:8227742-8227764 AGGCCCTGCCCTTCCTAGAGCGG + Exonic
978412499 4:108440994-108441016 TGGCTATGCCCTGCCCACAGAGG + Intergenic
978860862 4:113447186-113447208 TAGCTCTGCCCTTGCAAGAGAGG - Intergenic
980090380 4:128437078-128437100 TGGCTATGCCCTTCCCCCAGAGG + Intergenic
981774956 4:148355633-148355655 TGGCCCTGCCCTTCCTGTAGGGG - Intronic
981839459 4:149094162-149094184 TGGCTATGCCCTTCCCCCAGAGG + Intergenic
983173710 4:164563693-164563715 TGGCTATGCCCTTCCCCCAGAGG - Intergenic
983949065 4:173618820-173618842 TGGCTATGCCCTGCCCACAGAGG + Intergenic
990071720 5:51790726-51790748 TGGCTATGCCCTGCCCCAAGAGG + Intergenic
994287869 5:97991864-97991886 TGGCTATGCCCTGCCCACAGAGG - Intergenic
995285813 5:110386963-110386985 TGGTTCTGCTCTTCTGAAAAAGG + Intronic
995417658 5:111927806-111927828 GGCCTCTGCCTTTCCCAAAGAGG - Intronic
997874420 5:137535666-137535688 TGGCTCTGCCCTGCCCCCAGAGG - Intronic
1001651478 5:173319100-173319122 TGGCTCTGCCCTCCAGAACTAGG - Intronic
1002109205 5:176896754-176896776 TGGATCTGTGCTTCAGAAAGGGG + Intronic
1007348520 6:41251304-41251326 TGGCTCTGCCCTTCAGCAGCAGG - Intergenic
1007608020 6:43130261-43130283 TTGCTCTGACCATCAGAAAGGGG - Exonic
1008605757 6:53137799-53137821 TGGCTCTGACCAGCCTAAAGTGG - Intronic
1013124485 6:107170054-107170076 TGGCTATGCCCTGCCGCCAGAGG + Intronic
1015937384 6:138417014-138417036 TGGCTCTACCCTGGGGAAAGAGG + Exonic
1017845336 6:158253393-158253415 TGTCTCTGCCCTGCCGTAAGTGG + Intronic
1018513014 6:164546573-164546595 TGCCTCTGCCATTCATAAAGTGG - Intergenic
1019606194 7:1911410-1911432 TGGCGCTTCCCTTCCGAAGCTGG - Intronic
1020890485 7:13871952-13871974 TGTCTCAGCTCTTCAGAAAGTGG - Intergenic
1020924381 7:14306628-14306650 TGGCTCTGCGCTTCAGAACTGGG + Intronic
1022500391 7:30878891-30878913 TGGCTCTGACCTGGTGAAAGTGG - Intronic
1023839380 7:44087905-44087927 TGGCTCTGCCGCTCAGACAGAGG - Intergenic
1026827507 7:73593739-73593761 TGGCTCTGCCCTTCCCTGGGGGG - Exonic
1027715043 7:81659248-81659270 AGGCTCTGCCCTTAAGGAAGTGG - Intergenic
1028065241 7:86375919-86375941 TGGCTATGCCCTTCCCCCAGAGG - Intergenic
1033014750 7:137661051-137661073 TGGCTGTCCCCTTCTGAATGAGG + Intronic
1035242337 7:157540333-157540355 TGGATCCACCCTCCCGAAAGTGG + Exonic
1038226185 8:25660380-25660402 TGTCTGTGCCCTTCCCCAAGAGG + Intergenic
1043082024 8:75778421-75778443 TGGCTCTGCTCTGCCAACAGAGG - Intergenic
1046912521 8:119644885-119644907 CGACTCAGCCCTTCTGAAAGGGG - Intronic
1049432764 8:142572986-142573008 TAGCTCTGCCCTTTAAAAAGAGG - Intergenic
1050146443 9:2573162-2573184 TGGCTTTGCCCTGGCCAAAGAGG + Intergenic
1051406504 9:16743394-16743416 TGGTTCTACCCCTCTGAAAGAGG + Intronic
1052153857 9:25156600-25156622 TGGCTATGCTCTTCAGAAAAAGG + Intergenic
1053489618 9:38488848-38488870 TGGCACTGCCCTTAGGGAAGGGG - Intergenic
1056232700 9:84563415-84563437 AGGCTCTTCCCTTCCTAAAAAGG - Intergenic
1057669962 9:97078156-97078178 TGGCTCAGCCCTTAGGGAAGGGG - Intergenic
1057855316 9:98596779-98596801 TGACTCTGCCCCTCCAAACGCGG - Intronic
1058202966 9:102066771-102066793 TGGCTATGCCCTGCCCACAGAGG + Intergenic
1058563953 9:106260935-106260957 TGGCTATGCCCTGCCCCAAGAGG + Intergenic
1058783653 9:108364680-108364702 TGGGTCTGCCTTTCTGAAAGAGG + Intergenic
1060193878 9:121610482-121610504 TGGCTCTGCCCTTCCCAGCTGGG - Intronic
1060922157 9:127428845-127428867 AGGCCCTGCCCTTCCCCAAGAGG + Exonic
1061672192 9:132194900-132194922 TGGCTCAGCCCCTCAGAAGGCGG + Intronic
1062064868 9:134521373-134521395 TTGCTCTGCCCTACCCAAGGAGG + Intergenic
1188539459 X:31233368-31233390 TGGCTCTGCCCTGGCGAATCTGG - Intronic
1188889113 X:35587747-35587769 TGGGTCTGGCCTGCCCAAAGTGG - Intergenic
1190442932 X:50493885-50493907 TGTCTCTGCCCCTCCCTAAGTGG + Intergenic
1191087691 X:56587106-56587128 TGTCTGTGCCCTTCCCACAGAGG + Intergenic
1191092148 X:56635151-56635173 TGTCTGTGCCCTTCCCACAGAGG + Intergenic
1191843014 X:65526444-65526466 TGGCTCTACCCTTCAGCAAAAGG - Intronic
1194968789 X:100319789-100319811 TGCCTCTGCCTTTCCCAAAATGG - Intronic
1201494249 Y:14576165-14576187 TGGCTATGCCCTTCCCCCAGGGG + Intronic