ID: 1064255858

View in Genome Browser
Species Human (GRCh38)
Location 10:13742298-13742320
Sequence CTGGGGAATCCCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064255846_1064255858 8 Left 1064255846 10:13742267-13742289 CCACCCCCGCTTTCGGAAGGGCA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255845_1064255858 9 Left 1064255845 10:13742266-13742288 CCCACCCCCGCTTTCGGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255848_1064255858 4 Left 1064255848 10:13742271-13742293 CCCCGCTTTCGGAAGGGCAGAGC 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255849_1064255858 3 Left 1064255849 10:13742272-13742294 CCCGCTTTCGGAAGGGCAGAGCC 0: 1
1: 0
2: 1
3: 3
4: 112
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255847_1064255858 5 Left 1064255847 10:13742270-13742292 CCCCCGCTTTCGGAAGGGCAGAG 0: 1
1: 0
2: 0
3: 22
4: 88
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255842_1064255858 14 Left 1064255842 10:13742261-13742283 CCGCTCCCACCCCCGCTTTCGGA 0: 1
1: 0
2: 3
3: 17
4: 194
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data
1064255850_1064255858 2 Left 1064255850 10:13742273-13742295 CCGCTTTCGGAAGGGCAGAGCCA 0: 1
1: 0
2: 0
3: 2
4: 122
Right 1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064255858 Original CRISPR CTGGGGAATCCCAGGGAAGC AGG Intronic
No off target data available for this crispr