ID: 1064259693

View in Genome Browser
Species Human (GRCh38)
Location 10:13775337-13775359
Sequence CCATTGTTGGGGAGCCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064259678_1064259693 29 Left 1064259678 10:13775285-13775307 CCCATCCTGAAATTTTAGATCAG 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1064259693 10:13775337-13775359 CCATTGTTGGGGAGCCCAAGGGG No data
1064259681_1064259693 24 Left 1064259681 10:13775290-13775312 CCTGAAATTTTAGATCAGAAGGA 0: 1
1: 0
2: 0
3: 22
4: 226
Right 1064259693 10:13775337-13775359 CCATTGTTGGGGAGCCCAAGGGG No data
1064259679_1064259693 28 Left 1064259679 10:13775286-13775308 CCATCCTGAAATTTTAGATCAGA 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1064259693 10:13775337-13775359 CCATTGTTGGGGAGCCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064259693 Original CRISPR CCATTGTTGGGGAGCCCAAG GGG Intronic
No off target data available for this crispr