ID: 1064270125

View in Genome Browser
Species Human (GRCh38)
Location 10:13857962-13857984
Sequence GACACTGATGTGTTCTTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064270123_1064270125 0 Left 1064270123 10:13857939-13857961 CCAATTACTTCTCCAATTTTGCT 0: 1
1: 0
2: 2
3: 18
4: 315
Right 1064270125 10:13857962-13857984 GACACTGATGTGTTCTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064270125 Original CRISPR GACACTGATGTGTTCTTAGT TGG Intronic
No off target data available for this crispr