ID: 1064270419

View in Genome Browser
Species Human (GRCh38)
Location 10:13860273-13860295
Sequence TGCCATAAAAATAATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064270417_1064270419 3 Left 1064270417 10:13860247-13860269 CCTCAAGCTCATAGAAAACAGTT 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1064270419 10:13860273-13860295 TGCCATAAAAATAATTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064270419 Original CRISPR TGCCATAAAAATAATTAGGA AGG Intronic
No off target data available for this crispr