ID: 1064271808

View in Genome Browser
Species Human (GRCh38)
Location 10:13872170-13872192
Sequence GCGCCCCCGGGCCTTCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064271808_1064271819 24 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271819 10:13872217-13872239 AGGTCTCCTGTGGCTCTGGATGG No data
1064271808_1064271817 20 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271817 10:13872213-13872235 TGCCAGGTCTCCTGTGGCTCTGG No data
1064271808_1064271815 14 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271815 10:13872207-13872229 CCCTCATGCCAGGTCTCCTGTGG No data
1064271808_1064271812 4 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271812 10:13872197-13872219 GGTCTCTGTCCCCTCATGCCAGG No data
1064271808_1064271820 25 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG No data
1064271808_1064271822 30 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271822 10:13872223-13872245 CCTGTGGCTCTGGATGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064271808 Original CRISPR GCGCCCCCGGGCCTTCCTAT AGG (reversed) Intronic
900123564 1:1059613-1059635 ACGCCCCCCGGCCTTCTTAAAGG - Intergenic
901251691 1:7784228-7784250 CCGCCCCCGGGCCGTGCGATTGG - Intergenic
902629418 1:17695841-17695863 CCACCCCCAGGGCTTCCTATTGG - Intronic
903220829 1:21868890-21868912 GCTGCCCCGGGCCTTCCTGGGGG - Intronic
903868752 1:26417170-26417192 GCGCCCTCGGGCTTACCTTTGGG + Intronic
903907834 1:26697952-26697974 CCGTCCCCCGGCCTTCCTCTGGG + Intronic
904837616 1:33349544-33349566 GCGGCCCCCGGCCTCCCTACTGG + Intronic
1064271808 10:13872170-13872192 GCGCCCCCGGGCCTTCCTATAGG - Intronic
1076014337 10:127015577-127015599 GTGCCCCCGGGACTTGCTAGTGG + Intronic
1080592650 11:33736804-33736826 GTGCCCCAGGGCCTGGCTATCGG + Intergenic
1083946309 11:65924997-65925019 GCACCCCCGAGCCCTCCTCTAGG + Intergenic
1084960364 11:72713199-72713221 GGGCCCCCGGCCCCTCCTCTGGG + Exonic
1089078785 11:115759799-115759821 GCGACCTCGGGCCTTCCCTTAGG - Intergenic
1090128831 11:124118221-124118243 GGGCCACCAGGCCTTCTTATTGG + Exonic
1096521903 12:52189193-52189215 TCACCCCTGGGCCTTCCTCTGGG + Intronic
1097013044 12:55966737-55966759 CCGCCCCCAGGCCTTTCTATTGG - Intronic
1099133348 12:78863951-78863973 GCGCTCCCGGCCCCACCTATGGG + Intergenic
1102300421 12:111767151-111767173 GCGGCGCGGGGCCTTCCTAGGGG - Intronic
1104051106 12:125194460-125194482 ACTCCCCCGGGCCTTCCAAGGGG + Intronic
1107467442 13:40664410-40664432 GGGCCCCCGGGCCTTCTCCTCGG + Intronic
1115805957 14:37051849-37051871 TCCCACCAGGGCCTTCCTATTGG + Intronic
1122486775 14:102087193-102087215 CCGCCCCCGCGCCTTCCTGCGGG + Intronic
1129817128 15:78565290-78565312 CCGCCTCCAGGCCTTCCTTTGGG - Intergenic
1132729090 16:1351846-1351868 GCGCCCCTCGGCCTCCCAATGGG + Exonic
1137053929 16:35734603-35734625 ACGGCCCGGGGCCTTCCTGTGGG + Intergenic
1137057349 16:35752041-35752063 GCGACCTGGGGCCTCCCTATGGG + Intergenic
1137057874 16:35754035-35754057 GCGGCCCGGGGCCTTCCTGTGGG + Intergenic
1140046103 16:71441551-71441573 GCGCCCCAGGGCCTGGCTCTTGG + Intergenic
1144565067 17:16353205-16353227 GCTCCCCCGGGCCCTCCTCCTGG + Exonic
1150211980 17:63446579-63446601 GCTCCCCCGGGCCTGCCTCGAGG + Intergenic
1154199360 18:12288480-12288502 GGTCCCCCGGGCCTTTCTCTTGG - Intergenic
1161698652 19:5783700-5783722 GCGGGGCCGGGCCTTCCTCTAGG + Exonic
1165445852 19:35856493-35856515 GCTCCCCCGGGCCTGCGTGTCGG - Intronic
1168314085 19:55476549-55476571 CCGCCCCCGGACCCTCCCATTGG - Exonic
926101799 2:10122673-10122695 GCGCTCCCGGCCCTTCCCATTGG - Exonic
926325035 2:11778142-11778164 GGGCCCACGTGCCTTCTTATAGG + Intronic
941987593 2:171523494-171523516 TCCCCCGCGGGGCTTCCTATTGG + Intronic
942471895 2:176269376-176269398 CCGCCCCCGCGCCGTCCTACGGG - Intronic
1171386129 20:24770464-24770486 CAGACCCCGGGCCTTCCTAATGG + Intergenic
1173605189 20:44326749-44326771 GCGCCCCCGCGCCTTGCCACCGG - Intergenic
1173891341 20:46513440-46513462 TCGCCGCCAGCCCTTCCTATAGG + Exonic
1175433154 20:58921491-58921513 GTGCCCCAGGGCCTTCCTCGTGG - Intergenic
1178894811 21:36549566-36549588 GCCCCACCGGCCCTTCCTCTGGG - Intronic
1179628757 21:42664032-42664054 TCGGCCCCGGGCCGTCCTCTGGG - Intronic
1181802891 22:25358794-25358816 GCTCCTCCGGGACTTCCCATCGG + Intronic
950053941 3:10010963-10010985 GAGCCCCCGGATCTTCCCATGGG - Intronic
950547403 3:13646547-13646569 GGGGCCCCTGGCCTTCCTGTTGG + Intergenic
961792867 3:129389143-129389165 AGGCCCCTGGGCCTTCCTACTGG - Intergenic
961806786 3:129495335-129495357 AGGCCCCTGGGCCTTCCTACTGG - Intronic
987042271 5:14074217-14074239 GCTCCACCAGGCCTTCCTAAAGG + Intergenic
990728947 5:58787153-58787175 GAGCTCCCGGGGCTTCCCATGGG - Intronic
1006392965 6:33769652-33769674 GCTCTCCCGCGCCTTCCTTTTGG + Intergenic
1017552503 6:155523998-155524020 GCTTCTCCAGGCCTTCCTATGGG + Intergenic
1018721960 6:166580093-166580115 GGGCCCCCGGGCCTGCCCCTTGG + Intronic
1019523476 7:1470654-1470676 GCTCCACCGGGCCTTCCTGGTGG - Exonic
1029256168 7:99271110-99271132 GCTCCTCTGGGCCTTCCTGTCGG - Intergenic
1037910744 8:22742282-22742304 GCGCCCCTGGTCCTTGCTGTGGG + Intronic
1038436725 8:27541585-27541607 CCGCCCGCGGGGCTTCCCATTGG + Intronic
1039973231 8:42338296-42338318 CAGCCCAGGGGCCTTCCTATGGG - Intergenic
1040915724 8:52565161-52565183 GCGCCCCCGGGGCCTCCCGTGGG + Exonic
1061162386 9:128902788-128902810 GAGGGCCCGGGCCTTCCTGTGGG + Intronic
1187155872 X:16719947-16719969 GCGCCCCAGGGCCGTCCCAGAGG - Intronic