ID: 1064271810

View in Genome Browser
Species Human (GRCh38)
Location 10:13872182-13872204
Sequence CAGAGACCTGCAGCGCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064271810_1064271822 18 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271822 10:13872223-13872245 CCTGTGGCTCTGGATGGGTGAGG No data
1064271810_1064271823 21 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271823 10:13872226-13872248 GTGGCTCTGGATGGGTGAGGAGG No data
1064271810_1064271812 -8 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271812 10:13872197-13872219 GGTCTCTGTCCCCTCATGCCAGG No data
1064271810_1064271819 12 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271819 10:13872217-13872239 AGGTCTCCTGTGGCTCTGGATGG No data
1064271810_1064271815 2 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271815 10:13872207-13872229 CCCTCATGCCAGGTCTCCTGTGG No data
1064271810_1064271817 8 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271817 10:13872213-13872235 TGCCAGGTCTCCTGTGGCTCTGG No data
1064271810_1064271820 13 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064271810 Original CRISPR CAGAGACCTGCAGCGCCCCC GGG (reversed) Intronic
900341933 1:2193716-2193738 CTGATCCCTGCAGGGCCCCCAGG - Exonic
901066042 1:6495127-6495149 CAGAGGCCTGCGGAGCCCCGAGG - Intronic
901634174 1:10663057-10663079 CTGAGACCTGCACGGCCCCCGGG + Intronic
902336956 1:15759272-15759294 AAGGGGCCTGGAGCGCCCCCGGG - Intronic
903769347 1:25754151-25754173 CAGAGAGCTGCAGGGTGCCCGGG - Intronic
904034871 1:27553097-27553119 CAGCGACTGGCAGAGCCCCCAGG - Exonic
904285460 1:29450733-29450755 CAGAACCCGGCAGCACCCCCTGG - Intergenic
904559292 1:31385981-31386003 CAGAGGCCTGCAGCTGGCCCAGG + Intergenic
904605826 1:31697059-31697081 CAGAGACCTCCAAGGCCCGCCGG - Exonic
905041582 1:34964339-34964361 GAGAGAGCTGCAGAGTCCCCAGG + Intergenic
905889953 1:41512816-41512838 CAGAGACCTGCGCCTCCCCGTGG - Exonic
908259292 1:62327264-62327286 CAGAGACCTGCAGAGACATCCGG - Intergenic
908877559 1:68695283-68695305 CAGAGTCCTGCAGTGCCCTAGGG + Intergenic
911849030 1:102791173-102791195 CATAAAGCTGCAGTGCCCCCTGG + Intergenic
912433654 1:109643505-109643527 GAGAGTCCAGCAGCGCGCCCTGG - Intergenic
915091440 1:153429010-153429032 CAGAGCCCTCCAGTGCCCCCTGG - Intergenic
915520591 1:156440114-156440136 GAGAGACCTCCAGAGCCCCGGGG - Intergenic
917526770 1:175795286-175795308 CAGAGACCTGCCGTGGCCCAAGG + Intergenic
919083220 1:192891254-192891276 CAGAGACCTGCAGAGGCACTGGG - Intergenic
1063974759 10:11406350-11406372 CAGACACCTGCAGCCACACCAGG + Intergenic
1064271810 10:13872182-13872204 CAGAGACCTGCAGCGCCCCCGGG - Intronic
1065936217 10:30522751-30522773 TAGTCTCCTGCAGCGCCCCCAGG + Intergenic
1067090097 10:43262101-43262123 CAGAGACCTGGAGAGCCCCATGG + Intronic
1067428555 10:46227227-46227249 CGGAGGCCTGCAGTGCCCCTGGG + Intergenic
1067688130 10:48480067-48480089 CAGAGACTTTCAGTGCCCCAGGG + Intronic
1069897967 10:71690493-71690515 CACAGACCTGGACCGCTCCCGGG + Intronic
1070309355 10:75262035-75262057 CAGAGGCCAGCAGCGCCACTGGG - Intergenic
1070329862 10:75409228-75409250 CAGTGCCCTGCAGCGCTCCCAGG + Intergenic
1073137018 10:101225768-101225790 GTGATACCTGCAGCGCTCCCGGG + Intergenic
1074463937 10:113665633-113665655 CAAAGACCTGCAGGGTTCCCCGG + Intergenic
1074780226 10:116797113-116797135 GAGAAACCTGTAGCTCCCCCTGG - Intergenic
1076691297 10:132225007-132225029 CAGGCACCAGCAGCGGCCCCGGG + Intronic
1076859824 10:133135489-133135511 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076859916 10:133135732-133135754 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076859948 10:133135812-133135834 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076859976 10:133135893-133135915 CAGAGACCAGCTGCCCCCACAGG - Intergenic
1076860027 10:133136027-133136049 CAGAGACCAGCTGCCCCCACAGG - Intergenic
1076860125 10:133136297-133136319 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860253 10:133136646-133136668 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860312 10:133136807-133136829 CAGAGACCAGCCGCCCCCCCAGG - Intergenic
1076860332 10:133136861-133136883 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860455 10:133137212-133137234 CAGAGACCAGCTGCCCCCACAGG - Intergenic
1076860587 10:133137588-133137610 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860670 10:133137830-133137852 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860691 10:133137883-133137905 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860712 10:133137936-133137958 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860722 10:133137963-133137985 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860780 10:133138129-133138151 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860790 10:133138156-133138178 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860800 10:133138183-133138205 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860822 10:133138238-133138260 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860852 10:133138319-133138341 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860883 10:133138401-133138423 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076860978 10:133138646-133138668 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076861010 10:133138726-133138748 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076861038 10:133138807-133138829 CAGAGACCAGCTGCCCCCACAGG - Intergenic
1076861056 10:133138861-133138883 CAGAGACCAGCTGCCCCCACAGG - Intergenic
1076861078 10:133138916-133138938 CAGAGACCAGCCGCCCCCACAGG - Intergenic
1076947998 10:133665019-133665041 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076948988 10:133668329-133668351 CCGAGGCCTCCAGCTCCCCCGGG - Intronic
1076949972 10:133671628-133671650 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
1076950956 10:133674927-133674949 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076951946 10:133678237-133678259 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076952935 10:133681547-133681569 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076953919 10:133684846-133684868 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076954903 10:133741198-133741220 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076955892 10:133744508-133744530 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076956882 10:133747818-133747840 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076957869 10:133751127-133751149 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076958854 10:133754426-133754448 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076959843 10:133757736-133757758 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1076960827 10:133761035-133761057 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
1077014046 11:392230-392252 CCGCGGCCTGCAGGGCCCCCAGG - Intergenic
1077037321 11:501705-501727 CAGGGACAAGCAGCGCCCCATGG + Intronic
1077378648 11:2217584-2217606 CACAGTCCTGCAGCACCCCCTGG - Intergenic
1078540700 11:12210907-12210929 CAGACACTGGCAGCACCCCCAGG + Intronic
1079076293 11:17387254-17387276 CAGCGACCTGCACCACCACCAGG - Exonic
1079275271 11:19029762-19029784 CAGTGTCCTGCAGAGCCCTCTGG + Intergenic
1080802047 11:35618488-35618510 CAGAGCCCCGCAGCGCCCCGCGG + Exonic
1081770520 11:45647984-45648006 CTGTGACCTGCAGCCACCCCAGG + Intergenic
1081906610 11:46674353-46674375 CTGACTCCTGCAGCACCCCCGGG + Intronic
1083233363 11:61337005-61337027 CAGAGACCTCCAGGCCCCTCGGG + Intronic
1083420024 11:62547156-62547178 CAGCCACCTTCAGAGCCCCCAGG - Intronic
1083544368 11:63537945-63537967 CAGAGAGCAGCAGAGGCCCCCGG + Intronic
1083848794 11:65353467-65353489 CAGTTGCCTGCAGCGCTCCCAGG + Intergenic
1084431898 11:69115865-69115887 CAGTGGCCTGCAGCACCCCTGGG - Intergenic
1088250840 11:107859609-107859631 CACAGACCTGAAGCGCCTTCAGG - Intronic
1088921174 11:114260680-114260702 CAGAGAGCTGCTGTGCCCCAAGG - Intronic
1089288428 11:117422467-117422489 AAGAGACCTTCAACGCCACCTGG - Intergenic
1089602284 11:119623462-119623484 CCCAGACCTCCAGAGCCCCCAGG - Intronic
1089769913 11:120795359-120795381 CAGAGGCCTCCAGGGTCCCCCGG - Intronic
1089920936 11:122208991-122209013 CAGAGACTTTCAGCCCCCACTGG + Intergenic
1090350572 11:126105295-126105317 CAGAGACTTGCCGCGCACCTGGG - Intergenic
1091067818 11:132533189-132533211 CAGATACCTGCAGCACCAGCAGG - Intronic
1092508144 12:9125107-9125129 CAGAGACCTGCAGAGACTTCGGG + Intergenic
1092818843 12:12334559-12334581 CAGGGGCCGGCAACGCCCCCTGG + Intronic
1094377112 12:29801963-29801985 CGGCCGCCTGCAGCGCCCCCAGG - Intergenic
1095949421 12:47773688-47773710 CACAGACCTGCCGCGCCGCCCGG + Intronic
1096676339 12:53228164-53228186 CAGAGAGCTGTAGGGCTCCCAGG - Intronic
1097185096 12:57192494-57192516 CACAGACCTGCAGCTTTCCCAGG + Intronic
1097687650 12:62706029-62706051 CAGAGTCCTGCAGTGTCCCCTGG + Intronic
1097836033 12:64273670-64273692 CAGAGCCCTGCAGACCCCTCTGG - Intronic
1101754755 12:107612879-107612901 CAGAGGCCAGCAGGGCCCCTCGG + Intronic
1102252038 12:111394091-111394113 CAGAGCCCTGAGGCGCACCCAGG + Intergenic
1103852814 12:123944172-123944194 CAGACACCTGCACCACCCCCTGG - Intronic
1103939331 12:124493298-124493320 CAGAAGCCAGCAGCACCCCCAGG + Intronic
1103971794 12:124677274-124677296 CAGAGGCCAGCAGAGACCCCGGG + Intergenic
1104464046 12:128976257-128976279 CAGTGTCCAACAGCGCCCCCAGG - Intronic
1104699622 12:130892109-130892131 CCGGCACCTGCAGCGCTCCCTGG + Intergenic
1104971989 12:132534916-132534938 CAGCTCCCTGCAGCGCTCCCAGG + Intronic
1105305237 13:19163963-19163985 CAGTCTCCTGTAGCGCCCCCAGG - Intergenic
1109377708 13:61519376-61519398 TAGTCTCCTGCAGCGCCCCCAGG - Intergenic
1109911888 13:68923299-68923321 TAGTCTCCTGCAGCGCCCCCAGG - Intergenic
1113821334 13:113215650-113215672 CAGAGACCTTCAGAGCCACATGG - Intronic
1113846406 13:113394129-113394151 GGGAGGCCGGCAGCGCCCCCTGG + Intergenic
1114491202 14:23103136-23103158 CAGAGTTCTGCAGAGTCCCCTGG - Intergenic
1116464375 14:45214515-45214537 CAGAGACCAGGGGCGCCGCCCGG + Intronic
1121911298 14:97794783-97794805 CTGAGACCTGCAGCCCCTACTGG - Intergenic
1122131474 14:99606328-99606350 GACAGACCTGCAGCTCCCCCAGG - Intergenic
1122538714 14:102484491-102484513 CAGAGACCCGCGGGGCCCACAGG - Intronic
1122558485 14:102593611-102593633 CAGGGACCCCCAGCGCCCCCAGG - Intronic
1122710887 14:103656972-103656994 CAGAGCCCTGGAGTGGCCCCTGG + Intronic
1123123433 14:105928641-105928663 CAGAGTCCTGCAGAGCCTCTGGG + Intronic
1123406079 15:20020145-20020167 CAGAGTCCTGCAGAGCCGCTGGG + Intergenic
1123494745 15:20814486-20814508 CAGGGACCTCCAGCGCTCCGCGG + Intergenic
1123515409 15:21026793-21026815 CAGAGTCCTGCAGAGCCGCTGGG + Intergenic
1123551240 15:21383579-21383601 CAGGGACCTCCAGCGCTCCGCGG + Intergenic
1128094350 15:64942577-64942599 CAGAGACCTTCCGGGCCCCAGGG + Intronic
1128766473 15:70254073-70254095 CAGAGACCTGCAAGACCCCTTGG - Intergenic
1128859114 15:71050668-71050690 CAGAGACATGCAGAGACACCTGG + Intronic
1131097485 15:89665752-89665774 CAGAGCCCCGGCGCGCCCCCCGG - Exonic
1132356401 15:101174333-101174355 CTGAGACCTGCAGCCCCTGCTGG - Intergenic
1202959581 15_KI270727v1_random:110822-110844 CAGGGACCTCCAGCGCTCCGCGG + Intergenic
1132554147 16:565271-565293 CTGTGGCCTGCAGAGCCCCCAGG + Exonic
1132800079 16:1747717-1747739 CAGTAACCTGCATCGCCCCACGG + Intronic
1132800088 16:1747757-1747779 CAGTAACCTGCATCGCCCCACGG + Intronic
1132800097 16:1747797-1747819 CAGTAACCTGCATCGCCCCACGG + Intronic
1132951267 16:2563726-2563748 CAGAGACGTGCAGGGCCCCGGGG - Intronic
1132963083 16:2636444-2636466 CAGAGACGTGCAGGGCCCCGGGG + Intergenic
1133198104 16:4184742-4184764 CAGAAACCTGCAGTGGCCTCAGG + Intergenic
1137251107 16:46741571-46741593 CAGAGCCTTGCTGGGCCCCCAGG + Intronic
1137613853 16:49835689-49835711 CAGAAACCTCCAGGGTCCCCAGG + Intronic
1138394829 16:56695812-56695834 CAGAGACCTGCAGAGACCTCAGG + Intronic
1138475226 16:57266646-57266668 GAGAGACCTGCAGGGCCCAGGGG - Intronic
1139403096 16:66697154-66697176 CAGAGACGGGCTGCGCCACCCGG + Intergenic
1141565674 16:84900041-84900063 CAGAAACCAGCAGGGCCGCCAGG + Intronic
1141933319 16:87218818-87218840 CACAGACCTGCCCCACCCCCGGG + Intronic
1142023891 16:87801977-87801999 GAGGGACCTGCAGGGCACCCAGG - Intergenic
1142416896 16:89948167-89948189 CAGCCACCTGCAGGGCCCCGCGG - Intronic
1143057014 17:4170106-4170128 CACAGACCAGCTGTGCCCCCTGG + Intronic
1143949820 17:10623676-10623698 CAGAAACCTGCAAGTCCCCCTGG + Intergenic
1144821216 17:18076079-18076101 GCCAGACCTGCAGAGCCCCCAGG + Intergenic
1147757367 17:42777933-42777955 CAGAGACCTGCAGGGCAGCAGGG - Intronic
1148048844 17:44759472-44759494 CAGAGACCTGCAGAGCTGGCCGG - Intronic
1148796380 17:50199308-50199330 CAGGGACCCGCAGGCCCCCCTGG - Exonic
1149776880 17:59365279-59365301 CTGAGACCTGCTGGTCCCCCTGG - Intronic
1150632670 17:66890939-66890961 CAGATACTTGCAGCACCCCAAGG + Intergenic
1151451586 17:74201251-74201273 CAAAGACCTCCAGCTCCCCAAGG - Intergenic
1151677441 17:75605905-75605927 CCGGGACCAGCAGCGCTCCCAGG + Intergenic
1151933746 17:77248750-77248772 CAGCGAGCTGCAGCTCTCCCTGG + Intergenic
1151993663 17:77595091-77595113 CAGGGACCAGCAGAGCCCCAGGG - Intergenic
1152123203 17:78431466-78431488 CTGAGAGCTACAGCTCCCCCAGG - Intronic
1152844019 17:82588345-82588367 CAGCTACCTGCAGTGCCACCAGG - Intronic
1152965845 18:112500-112522 CCGAGGCCTCCAGCTCCCCCGGG + Intergenic
1153654777 18:7272879-7272901 CTGAGACCAGCAGAGCCCACAGG + Intergenic
1154452147 18:14487007-14487029 CAGGGACCTCCAGCGCTCCGCGG + Intergenic
1155203674 18:23538637-23538659 CAGAGGCCTGCAGCGAACGCAGG + Exonic
1160731285 19:642724-642746 CAGCGACCAGCAGCACCCCAGGG - Intronic
1160832712 19:1111166-1111188 CAGAGACCAGCAGCTCCCTGGGG + Intronic
1161556261 19:4944448-4944470 CAGGTACCTGCAGCGTCCCGGGG + Exonic
1161579847 19:5074839-5074861 CACAGACCTCAAGCGCCTCCAGG - Intronic
1161613627 19:5257674-5257696 CAGAGGCCTGCAGGCTCCCCTGG + Intronic
1163773022 19:19202141-19202163 GAGGGACCTGCAGCTTCCCCAGG - Intronic
1165074585 19:33273743-33273765 CAGGGACCTACAGGGCCCCAAGG + Intergenic
1165300544 19:34965643-34965665 TAGTCTCCTGCAGCGCCCCCAGG + Intergenic
925008951 2:467835-467857 CAGAGACCTGCTGCACGCCGGGG + Intergenic
925066656 2:933056-933078 CAGAGCCCCGCAGCGCTGCCTGG - Intergenic
925134105 2:1514571-1514593 CAGAGAACTCCAGGGCTCCCCGG + Intronic
925141225 2:1550943-1550965 CAGAAACCTGCAGGGACCTCGGG - Intergenic
925181161 2:1817705-1817727 CCGGGACCAGCACCGCCCCCAGG - Intronic
925546715 2:5024556-5024578 CAGAGACCAGCTGGGCCCCGGGG + Intergenic
925585113 2:5457455-5457477 CAGAGACCTGCAGAGGCAGCAGG + Intergenic
926124870 2:10265761-10265783 CAGAAGCCTGCAGCGGCCCCGGG - Intergenic
928199940 2:29241423-29241445 CAGAGATTTGCAGCTTCCCCGGG - Intronic
929172467 2:38945555-38945577 CAGAGGCCTGCAGCGCAGCTGGG - Intronic
931882437 2:66581641-66581663 CAGAGCCTTGCAGAGCCCCAGGG - Intergenic
932579694 2:72985285-72985307 CGGAGACCTGCAGTGAACCCCGG + Intronic
933690345 2:85174841-85174863 CAGGGACCTGCAGTGACCCAAGG - Intronic
934477672 2:94604020-94604042 GAGGGTCCTGCAGAGCCCCCAGG + Intronic
935114987 2:100127667-100127689 CAGAGGCCTGGAGAGCTCCCAGG + Intronic
936156115 2:110048382-110048404 GAGCAACCTGCAGTGCCCCCTGG - Intergenic
936188573 2:110323046-110323068 GAGCAACCTGCAGTGCCCCCTGG + Intergenic
936765812 2:115847652-115847674 CAGATAACTGCAGCTGCCCCAGG + Intergenic
937120405 2:119436834-119436856 CACAGCCCTGCCACGCCCCCAGG - Intronic
937227938 2:120380450-120380472 CAGCATCCTGCAGGGCCCCCAGG + Intergenic
937907269 2:127058449-127058471 CAGACACCTGGAGGGCCCGCTGG + Intronic
940372475 2:152918430-152918452 CAAATACCTGCAGCTCTCCCAGG - Intergenic
941096845 2:161247027-161247049 CAGAGATAGGCAGCACCCCCAGG - Intergenic
942646055 2:178112359-178112381 GAGCGGCCTGCAGCGCCCCCTGG - Intergenic
944631831 2:201634755-201634777 CATAGACCCTCAGTGCCCCCAGG + Intronic
947385623 2:229587528-229587550 AAGAGACCTACAGTGCCCGCAGG + Intronic
948476071 2:238220865-238220887 CAGAGACCTGCAGAGACCTTGGG - Intergenic
948909284 2:240994908-240994930 CTGTGACCTGCAGAGCCCCGAGG + Intergenic
1168730991 20:80463-80485 AGGAGACCTGCAGCTCCCCTGGG - Intergenic
1168757891 20:328411-328433 CAGAGACCTGCAGAGACCCTGGG - Exonic
1169919920 20:10724204-10724226 CAGAGCCCTGGAGCTCCCCGGGG + Intergenic
1172182331 20:33011049-33011071 CAGTGACCTGCAGGGCCCGCTGG - Exonic
1174147106 20:48459651-48459673 CACAGACCTGCCCGGCCCCCAGG + Intergenic
1174168938 20:48604437-48604459 CAGAGCCCTACAGGGCCTCCAGG - Intergenic
1175163806 20:57029072-57029094 GAGAGACCTGCTGGGCCCCATGG + Intergenic
1175257890 20:57657894-57657916 CAGAGACGTGCCGCAGCCCCAGG + Intronic
1175972840 20:62695630-62695652 CAGCGTCCTCCAGGGCCCCCAGG + Intergenic
1176216729 20:63951612-63951634 CAGGGACCTGCAGCCACCCAGGG + Intronic
1176308359 21:5136170-5136192 GAGAGCCCTGCAGTGCCCCAGGG + Intronic
1179101566 21:38359309-38359331 CTGAGACCTGCAACCCCACCTGG - Intergenic
1179769512 21:43603941-43603963 CACTGACCTGCAGGGCCCACAGG + Intronic
1179848701 21:44125862-44125884 GAGAGCCCTGCAGTGCCCCAGGG - Intronic
1179981701 21:44899320-44899342 CAGAGAGCTGCCACGCCCTCTGG + Intronic
1180003422 21:45006113-45006135 CAGAGACCTTCAGAGACCTCCGG - Intergenic
1180158406 21:45988533-45988555 CAGAAGCCCCCAGCGCCCCCGGG - Intronic
1180198812 21:46212850-46212872 CAGAGACCAACAGCACCCACAGG + Intronic
1180950407 22:19718258-19718280 GGGAGCCCTGCCGCGCCCCCGGG - Intronic
1181441737 22:22939565-22939587 TAGAGAACTGCAGGTCCCCCAGG - Intergenic
1181671610 22:24427962-24427984 CAGAGAGCTGCAGCTGCACCCGG + Intronic
1181897837 22:26126393-26126415 CAGAGAGCTGCCTCGCCCCAGGG - Intergenic
1181898426 22:26131742-26131764 ATGAGACGTGCAGTGCCCCCCGG + Intergenic
1182295431 22:29309215-29309237 GGGAGACCTGCAGAGCCCCCTGG - Intronic
1183079310 22:35446477-35446499 CACAGAGCTGCTGCGCACCCTGG + Intergenic
1184140020 22:42573136-42573158 AAGAAACCTGCAGAGGCCCCAGG - Intronic
1184433897 22:44458504-44458526 CAGAGCCCTGCAGCTGCCCTGGG - Intergenic
1184921249 22:47607404-47607426 CAGAGAACTGCAGATCCTCCTGG + Intergenic
1185047798 22:48537683-48537705 CAGGGTCCTGCAGCTCTCCCTGG + Intronic
950613029 3:14138310-14138332 CAGAGCCCTGCCACACCCCCCGG - Intronic
950678208 3:14567387-14567409 CAGAGGCATGCAGGGTCCCCAGG - Intergenic
951302012 3:21009695-21009717 GAGTCTCCTGCAGCGCCCCCAGG + Intergenic
953549654 3:43891672-43891694 CAGAGAGGTGCAGTGGCCCCTGG - Intergenic
959002976 3:100986162-100986184 CAGAGACCTGCAGCAACCTCAGG + Intronic
959873980 3:111360390-111360412 CTGAGCCCTGCAGAGACCCCGGG + Intronic
964475326 3:157092604-157092626 CAGAGGCTTGCAGTGCACCCAGG + Intergenic
968180619 3:196592450-196592472 TCGTGACCAGCAGCGCCCCCAGG - Intergenic
968689797 4:1984573-1984595 CACAGACAGGCAGCGGCCCCAGG - Intronic
969376686 4:6767957-6767979 CAGTGACCTGCTGGTCCCCCGGG - Intergenic
971288460 4:25312718-25312740 AAGCGACCCACAGCGCCCCCAGG - Intergenic
973708370 4:53601818-53601840 GAGTGACCTGCAGTGACCCCTGG - Intronic
974199440 4:58620174-58620196 CAGTCTCCTGCAGCGCTCCCAGG + Intergenic
976679895 4:87745324-87745346 CAGAGACCTGCAGAGGCGCTGGG - Intergenic
977471889 4:97452687-97452709 CAGAGACCTGCAGAGACATCAGG + Intronic
977555675 4:98485309-98485331 CAGAAACCTGGGGAGCCCCCAGG - Intronic
979311905 4:119212909-119212931 CAGAGACCTGCGACCCCCGCGGG + Intronic
980495605 4:133585447-133585469 CAGACACCTGCAACGCACCGTGG + Intergenic
982391942 4:154874195-154874217 CAGTCTCCTGTAGCGCCCCCAGG - Intergenic
983706060 4:170660697-170660719 CAGAGCACTGCAGTGCCTCCAGG - Intergenic
983927529 4:173417837-173417859 CAGAGACCTGCAACACACCTTGG + Intergenic
984337881 4:178415640-178415662 CAGAGAGCTGCACAGACCCCTGG + Intergenic
984849850 4:184144044-184144066 CAGAGGCTGGCAGGGCCCCCCGG + Intronic
985451455 4:190065827-190065849 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
985452444 4:190069119-190069141 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
985453429 4:190072416-190072438 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985454419 4:190075709-190075731 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985455407 4:190079002-190079024 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985456392 4:190082296-190082318 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985457379 4:190085596-190085618 CCGAGGCCTCCAGCTCCCCCGGG - Intergenic
985458366 4:190088889-190088911 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985459355 4:190092189-190092211 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985463607 4:190174958-190174980 CCGAGGCCTCCAGCTCCCCCGGG - Exonic
985530448 5:430962-430984 CCGAGCCCTGCAGAGACCCCAGG - Intronic
985569249 5:635534-635556 CAGAGGCCTCCCGTGCCCCCAGG + Exonic
985838077 5:2284887-2284909 CAGAGACATGCCGCAGCCCCAGG - Intergenic
987962770 5:24831905-24831927 CAGAGATCTGCAACGCCTACAGG - Intergenic
988720205 5:33869862-33869884 TAGTCTCCTGCAGCGCCCCCAGG - Intronic
995019070 5:107346730-107346752 TAGTCTCCTGCAGCGCCCCCAGG - Intergenic
995687680 5:114788815-114788837 CAGAGGGCTGCAGCAACCCCTGG - Intergenic
996765465 5:127030788-127030810 GAGAGTCCCGCAGCGCCCGCCGG - Exonic
997513499 5:134468661-134468683 CAGTCACCTGCAGCATCCCCTGG + Intergenic
997738075 5:136229050-136229072 CAGAGACCTGCAGCTTTTCCAGG + Intronic
997904416 5:137801192-137801214 CAGTGACCTTCAGTGCCCACTGG + Intergenic
998043378 5:138967757-138967779 CAGGGAACAGCAGCCCCCCCAGG + Intronic
999194241 5:149771292-149771314 AAGAGACCTGCATAGGCCCCTGG + Intronic
999380304 5:151116884-151116906 CAGGGACCTGCAGATCACCCAGG - Intronic
1000168362 5:158677379-158677401 GAAAGAAATGCAGCGCCCCCTGG - Intergenic
1000254939 5:159528675-159528697 CAGGGACCTGCAGAGAGCCCTGG + Intergenic
1002055036 5:176593912-176593934 CAGAGGCCTCCAGCGCTGCCTGG - Intronic
1002096564 5:176834762-176834784 CAGACTCCTGCAGCGACCCAGGG - Intronic
1002371115 5:178755518-178755540 CAGAGACCTGTAGCTCTCGCTGG - Intergenic
1002687311 5:181023958-181023980 GAGAATCCTGCAGCGCCCACAGG + Intergenic
1006867573 6:37221931-37221953 CAGAGACCTGCAGAGACGTCAGG - Intronic
1007170994 6:39863464-39863486 CTGAGAGCTGCAGGGCCCGCTGG + Intronic
1007380604 6:41488105-41488127 CAGAGTCCCTCAGCGCTCCCAGG + Intergenic
1010610732 6:77951725-77951747 AAGAGACCTGCATGGCACCCTGG + Intergenic
1016779619 6:147943559-147943581 CAGAAAGCTGCAGCCCCACCTGG + Intergenic
1017525700 6:155239860-155239882 CAGAGCCCTGCAGAGCGCACAGG - Intronic
1018504965 6:164456214-164456236 GAGAGACCAGCAGCGCCCCTTGG + Intergenic
1019268265 7:131330-131352 CTTAGACCTGCAGCCTCCCCAGG - Intergenic
1019531246 7:1504487-1504509 CTGATGCCTGCAGCGCCCCATGG + Intergenic
1019552191 7:1608546-1608568 GAAAGACCTGCAGCTCCCCAGGG - Intergenic
1019777146 7:2918568-2918590 CAGAGCCCAGCAGCTCCTCCTGG - Exonic
1021020086 7:15587089-15587111 TAGTCTCCTGCAGCGCCCCCAGG - Intergenic
1022286179 7:28957527-28957549 CCGCGTCCGGCAGCGCCCCCAGG + Exonic
1022663831 7:32390391-32390413 CAGATGCCAGTAGCGCCCCCAGG - Intergenic
1022686763 7:32604267-32604289 TAGTCTCCTGCAGCGCCCCCAGG - Intergenic
1023668857 7:42555152-42555174 TAGTCTCCTGCAGCGCCCCCAGG + Intergenic
1023870653 7:44261425-44261447 ATCAGCCCTGCAGCGCCCCCAGG - Intronic
1025208656 7:57008266-57008288 TGGAGACCTGCAGGGCCGCCGGG - Intergenic
1025663291 7:63568612-63568634 TGGAGACCTGCAGGGCCGCCGGG + Intergenic
1026807142 7:73435662-73435684 CCAAGGCCTGCCGCGCCCCCGGG + Exonic
1026970287 7:74463620-74463642 CAGAGCCCTGGAGGGCCCCAGGG + Intronic
1029250661 7:99233816-99233838 CAGAGACCTGCACGTCCCTCAGG + Intergenic
1029519155 7:101049164-101049186 CAGAGACCTGCTCCACCCCAGGG - Intronic
1030101135 7:105946229-105946251 CAGAGACCTGCAGGTCTCCATGG - Intronic
1034075932 7:148231295-148231317 CAGAGACCTGCAGAGAATCCAGG + Intronic
1034456292 7:151172747-151172769 CGGGGTGCTGCAGCGCCCCCTGG + Intronic
1034492780 7:151402855-151402877 CAGAGACCCTGAGGGCCCCCAGG - Intronic
1034551233 7:151822169-151822191 CAGACACCTGCAGCCTCCTCTGG + Intronic
1034928459 7:155141735-155141757 CACAGACCTGCAGGGCAGCCTGG - Intergenic
1035341822 7:158167065-158167087 CAGAGGCCCCCAGCTCCCCCCGG - Exonic
1035763198 8:2085180-2085202 CAGAGTCCTCCAGTGCCCCGAGG + Intronic
1036562244 8:9906892-9906914 CGGAGCCCTCCAGCGCGCCCGGG + Intergenic
1036940774 8:13049677-13049699 CAGAGACCTGCAGCCACTCCAGG - Intergenic
1037967221 8:23144536-23144558 CAGATACTTGCAGCCCACCCAGG - Exonic
1039111387 8:34043996-34044018 TAGTCTCCTGCAGCGCCCCCAGG - Intergenic
1041306868 8:56470754-56470776 CTGAGACCTGGAGGGGCCCCAGG + Intergenic
1041403819 8:57473963-57473985 CAGAGACCTGAGGCGACCCTAGG + Intergenic
1043495688 8:80797617-80797639 CAGAGACCTGCAAGGACCCTGGG + Intronic
1049163088 8:141110234-141110256 GAGAGGCGTGCAGGGCCCCCTGG + Intergenic
1049446917 8:142635438-142635460 CAGAGACCTGTGGCAGCCCCAGG + Intergenic
1049824028 8:144655382-144655404 CAGAGACCTGCAGAGACACCAGG + Intergenic
1053680389 9:40482087-40482109 GAGGGTCCTGCAGAGCCCCCAGG - Intergenic
1053930375 9:43110397-43110419 GAGGGTCCTGCAGAGCCCCCAGG - Intergenic
1054283323 9:63142848-63142870 GAGGGTCCTGCAGAGCCCCCAGG + Intergenic
1054293469 9:63317597-63317619 GAGGGTCCTGCAGAGCCCCCAGG - Intergenic
1054391495 9:64622090-64622112 GAGGGTCCTGCAGAGCCCCCAGG - Intergenic
1054504232 9:65894237-65894259 GAGGGTCCTGCAGAGCCCCCAGG + Exonic
1056589068 9:87951220-87951242 AGGAGACCTGCAGCTCCCCAAGG + Intergenic
1056689885 9:88798868-88798890 CAGAGTCCTGCAGCAACACCAGG - Intergenic
1056969060 9:91187476-91187498 CAGTGCCCTGCACCTCCCCCGGG - Intergenic
1058670770 9:107358988-107359010 CAGAGATCTGGAGCGGCCCAAGG + Intergenic
1059958217 9:119540590-119540612 CAGAGGCCTGCATGGCTCCCTGG + Intergenic
1060547509 9:124469972-124469994 CAAAGACCCGCATCGCCCTCTGG + Intronic
1060821067 9:126661833-126661855 GCCAGGCCTGCAGCGCCCCCTGG + Intronic
1061088458 9:128412650-128412672 CAGAAACCGGCAGCCCCACCAGG + Intronic
1061733799 9:132638131-132638153 AAGATACCTGCAGCCCGCCCTGG - Intronic
1062197248 9:135281231-135281253 CAGAGACCCCCAGCGCCACTGGG - Intergenic
1062530531 9:136997554-136997576 CAGAGACCTGGGGTGCCCACAGG + Intergenic
1203760790 EBV:12387-12409 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203761719 EBV:15459-15481 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203762648 EBV:18531-18553 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203763577 EBV:21603-21625 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203764506 EBV:24675-24697 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203765435 EBV:27747-27769 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203766364 EBV:30819-30841 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1203767293 EBV:33891-33913 CAGAGACAGGCAGGGCCCCCCGG + Intergenic
1187837226 X:23445201-23445223 TAGAGACCTACAGAGCCTCCAGG + Intergenic
1189254074 X:39623884-39623906 CAGGTACCTGCAGCTCTCCCAGG + Intergenic
1189301252 X:39954160-39954182 CAGAGACCTGCACTGCACCGGGG + Intergenic
1189350185 X:40270132-40270154 CAGAGACAGGCAGCGATCCCAGG + Intergenic
1189591526 X:42517493-42517515 CACTCACCTGCAGCGCTCCCAGG - Intergenic
1190279298 X:48918794-48918816 CAGGGGCCTCCCGCGCCCCCCGG - Exonic
1193939864 X:87668982-87669004 TAGAGACCTGCAGAGGCCCAGGG + Intronic
1197510172 X:127361419-127361441 CAGAGCCCTGCAGAGCCACAGGG - Intergenic
1199689569 X:150298104-150298126 CAGAGACCTTGCCCGCCCCCCGG - Intergenic
1201343013 Y:12954202-12954224 TAGCCTCCTGCAGCGCCCCCAGG - Intergenic