ID: 1064271811

View in Genome Browser
Species Human (GRCh38)
Location 10:13872183-13872205
Sequence ACAGAGACCTGCAGCGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 230}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064271811_1064271815 1 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271815 10:13872207-13872229 CCCTCATGCCAGGTCTCCTGTGG No data
1064271811_1064271819 11 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271819 10:13872217-13872239 AGGTCTCCTGTGGCTCTGGATGG No data
1064271811_1064271824 30 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271824 10:13872236-13872258 ATGGGTGAGGAGGCTAATTCTGG No data
1064271811_1064271820 12 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG No data
1064271811_1064271817 7 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271817 10:13872213-13872235 TGCCAGGTCTCCTGTGGCTCTGG No data
1064271811_1064271823 20 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271823 10:13872226-13872248 GTGGCTCTGGATGGGTGAGGAGG No data
1064271811_1064271812 -9 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271812 10:13872197-13872219 GGTCTCTGTCCCCTCATGCCAGG No data
1064271811_1064271822 17 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271822 10:13872223-13872245 CCTGTGGCTCTGGATGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064271811 Original CRISPR ACAGAGACCTGCAGCGCCCC CGG (reversed) Intronic
900163380 1:1235143-1235165 AGAGAGAGCTGCAGCTGCCCCGG - Intergenic
900396508 1:2455287-2455309 ACAGGGACCTGCCGGGCCTCTGG - Intronic
900482757 1:2907212-2907234 ACAGGGGTCCGCAGCGCCCCCGG - Intergenic
900511324 1:3062437-3062459 GCAGAGACCAGGATCGCCCCAGG - Intergenic
900896662 1:5487437-5487459 ACAGAGGCCTGGAGCTTCCCAGG - Intergenic
901217599 1:7563383-7563405 ACTGAGACCTGCAGCACAGCAGG + Intronic
901427623 1:9192561-9192583 ACAGTGACCTGCACCTCCCATGG - Intergenic
901634173 1:10663056-10663078 ACTGAGACCTGCACGGCCCCCGG + Intronic
902336957 1:15759273-15759295 AAAGGGGCCTGGAGCGCCCCCGG - Intronic
903142314 1:21345865-21345887 ACAAGCAGCTGCAGCGCCCCGGG - Intergenic
903693039 1:25187524-25187546 ACAGAGACCTCCAGAGAGCCAGG - Intergenic
905272521 1:36796255-36796277 ACAGAGATCTGCAGCCTCCTGGG + Exonic
908877558 1:68695282-68695304 TCAGAGTCCTGCAGTGCCCTAGG + Intergenic
910968606 1:92832060-92832082 ACAGAGACCTGCAGGCCCAGCGG - Exonic
913093905 1:115498360-115498382 ACAGAGGCCTGCGGTGCCCCAGG - Intergenic
915217448 1:154349546-154349568 CCAGAGACCTGCAGGGGCCTCGG + Exonic
915520592 1:156440115-156440137 TGAGAGACCTCCAGAGCCCCGGG - Intergenic
919083221 1:192891255-192891277 TCAGAGACCTGCAGAGGCACTGG - Intergenic
922321593 1:224493363-224493385 ACACAAACGTTCAGCGCCCCAGG - Intronic
922569989 1:226628904-226628926 TCAGAGACCTGCCTGGCCCCTGG - Intergenic
924045563 1:240025643-240025665 AGAGAGGCCTGCAGCTCCCTGGG + Intronic
1064271811 10:13872183-13872205 ACAGAGACCTGCAGCGCCCCCGG - Intronic
1064712380 10:18140586-18140608 GCAGCGCCCCGCAGCGCCCCGGG - Intergenic
1065468424 10:26050420-26050442 ACAGAAACTTGCAGCGGCTCTGG + Intronic
1067054755 10:43044104-43044126 AGAGACACCTGCAGGGCTCCCGG + Intergenic
1067428554 10:46227226-46227248 ACGGAGGCCTGCAGTGCCCCTGG + Intergenic
1067688129 10:48480066-48480088 TCAGAGACTTTCAGTGCCCCAGG + Intronic
1069712146 10:70496573-70496595 ACTGATACCTGCAGCGACACGGG - Intronic
1070309356 10:75262036-75262058 TCAGAGGCCAGCAGCGCCACTGG - Intergenic
1072028990 10:91498569-91498591 ACAGTGATCTGCAGAGCTCCAGG + Intronic
1073137017 10:101225767-101225789 AGTGATACCTGCAGCGCTCCCGG + Intergenic
1073593340 10:104777062-104777084 ACAGATACCTGCAGCGCAAGAGG - Intronic
1075078139 10:119365070-119365092 ACACGGAGCAGCAGCGCCCCAGG + Intronic
1075941545 10:126394539-126394561 ACAGCCACCAGCAGAGCCCCAGG - Intergenic
1076686233 10:132199655-132199677 CCAGGGACCTGCACAGCCCCAGG - Intronic
1077021025 11:417220-417242 CCAGGGACAAGCAGCGCCCCGGG + Intronic
1079329312 11:19520792-19520814 ACTGAGACCAGCAGAGCACCTGG - Intronic
1081412175 11:42772866-42772888 ACAGAGTCCTGCAGAACACCTGG - Intergenic
1081607792 11:44538029-44538051 AAAGAGACCTGCAGCCTACCCGG + Intergenic
1081755116 11:45538801-45538823 ACATAGACCTCCAGCTCCCCTGG - Intergenic
1081906609 11:46674352-46674374 ACTGACTCCTGCAGCACCCCCGG + Intronic
1083665595 11:64272487-64272509 CAAGGGACCTGCAGAGCCCCTGG + Intronic
1084431899 11:69115866-69115888 GCAGTGGCCTGCAGCACCCCTGG - Intergenic
1084717694 11:70884001-70884023 ACAGAGATCTGCAGGGAGCCAGG + Intronic
1085460128 11:76688636-76688658 ACAGACACCTGCCGCACACCTGG + Intergenic
1085642231 11:78199777-78199799 TCCCAGACCTGCACCGCCCCTGG - Intronic
1086061278 11:82702296-82702318 ACAGAGACCTGCCTCTCCCAAGG + Intergenic
1086860139 11:91915984-91916006 ACTGTGACCTGCATCACCCCTGG + Intergenic
1090350573 11:126105296-126105318 CCAGAGACTTGCCGCGCACCTGG - Intergenic
1090373576 11:126273594-126273616 ACACAGACCTGCAATGCCCTGGG + Intronic
1090798999 11:130159385-130159407 ACAGAAACCAGAACCGCCCCTGG - Intergenic
1092132795 12:6124331-6124353 ACAGAGAACTCCAGCTCCCCAGG + Intronic
1098138562 12:67428438-67428460 ACAGAGACCTGCTGGATCCCAGG - Intergenic
1101825751 12:108218806-108218828 ACAGACACCAGCAGTGTCCCTGG + Intronic
1102000894 12:109557570-109557592 AACTAGACCTGCAGAGCCCCGGG - Intronic
1103366758 12:120389529-120389551 TCAGAGGCCTGCAGCCCCCTGGG + Intergenic
1103555218 12:121762246-121762268 ACAGAGTCCTGCATTGTCCCTGG - Intronic
1104617052 12:130279515-130279537 ACACAGACCTGAAGCATCCCAGG + Intergenic
1107086194 13:36430661-36430683 ACTGAGTCCTTCAGCGACCCAGG + Intergenic
1107832822 13:44389668-44389690 GCCGAGACCAGCAGCCCCCCTGG + Intronic
1107926138 13:45263780-45263802 ACAGAGAGCTGCAACCCCCAGGG - Intronic
1109735161 13:66473850-66473872 ACAGAGACCTGCATATCCACAGG - Intronic
1113466213 13:110514989-110515011 ACAGTGACTTTCAGCACCCCTGG + Intergenic
1113716805 13:112515499-112515521 AAGGAGACCCGCAGAGCCCCAGG + Intronic
1120862865 14:89270435-89270457 ACAGAGACCTGCACAGTGCCTGG - Intronic
1122291358 14:100681943-100681965 TCAAAGTCCTGCAGAGCCCCCGG - Intergenic
1122315052 14:100821068-100821090 ACAGAGAACTGCAGAGGCCTGGG - Intergenic
1123115777 14:105893434-105893456 ACAGTGACCTTGAGAGCCCCAGG + Intergenic
1123123432 14:105928640-105928662 GCAGAGTCCTGCAGAGCCTCTGG + Intronic
1123402759 15:20003732-20003754 ACAGTGACCTTGAGAGCCCCAGG + Intergenic
1123406078 15:20020144-20020166 GCAGAGTCCTGCAGAGCCGCTGG + Intergenic
1123515408 15:21026792-21026814 GCAGAGTCCTGCAGAGCCGCTGG + Intergenic
1124118194 15:26867133-26867155 GCAGAGCCCCCCAGCGCCCCCGG - Intronic
1124375410 15:29126198-29126220 ACTGAGACCTGCAGCATCCAAGG + Intronic
1124654847 15:31499727-31499749 GCAGGGACCTGCATCGCCCCAGG + Intronic
1125381707 15:39092918-39092940 ACAGGGACCTCCTGCTCCCCAGG - Intergenic
1128094349 15:64942576-64942598 ACAGAGACCTTCCGGGCCCCAGG + Intronic
1130300569 15:82677445-82677467 AGACACACCTGCAGTGCCCCAGG + Intronic
1130620157 15:85453775-85453797 ACAGAGATCTGAAGTTCCCCTGG - Intronic
1131260244 15:90884227-90884249 CCAGGGCCCGGCAGCGCCCCGGG - Intronic
1132951268 16:2563727-2563749 GCAGAGACGTGCAGGGCCCCGGG - Intronic
1132963082 16:2636443-2636465 GCAGAGACGTGCAGGGCCCCGGG + Intergenic
1133043885 16:3075614-3075636 ACATAGCCCTGCAGCACCACAGG - Intronic
1134013814 16:10874607-10874629 TCAGAGACCTGCACCGACACAGG + Intergenic
1135334578 16:21590105-21590127 ACAGCTAACTGCAGCCCCCCTGG - Intergenic
1135958599 16:26977250-26977272 ACAGCGACCTGCTGTCCCCCAGG - Intergenic
1136419125 16:30121626-30121648 ACCCAGGCCTGCAGCGGCCCAGG - Intronic
1138475227 16:57266647-57266669 AGAGAGACCTGCAGGGCCCAGGG - Intronic
1141506338 16:84481018-84481040 AAAGAGACCTCCAGGGCCCAGGG + Intronic
1141719435 16:85747547-85747569 AAAGAGACCTTCAGCCCCCCAGG - Intronic
1143474878 17:7196790-7196812 ACTGAGGTCTGCAGGGCCCCCGG + Exonic
1144697058 17:17311965-17311987 ACTGTGCCCTGCAGCTCCCCAGG - Intronic
1146892535 17:36515239-36515261 CCAGAGACCTGCAGCCACCTTGG - Intronic
1147595649 17:41715552-41715574 ACAGGGACCTGGAGCTACCCTGG + Exonic
1147757368 17:42777934-42777956 GCAGAGACCTGCAGGGCAGCAGG - Intronic
1148462543 17:47846909-47846931 ACAGCCACCACCAGCGCCCCGGG + Exonic
1151310687 17:73290903-73290925 ACAGTGACCTGCAGCTTCTCTGG - Intronic
1151892330 17:76958128-76958150 ACACAGACCTTCAGGGCACCTGG + Intergenic
1151993664 17:77595092-77595114 CCAGGGACCAGCAGAGCCCCAGG - Intergenic
1152485228 17:80586671-80586693 ACAGGAAGCTGCAGCGCCCGGGG - Intronic
1152517234 17:80832692-80832714 AGACAGCCCTGCAGAGCCCCCGG - Intronic
1152963724 18:96736-96758 AGAGGGCCCTGCAGTGCCCCCGG - Intergenic
1152963774 18:96917-96939 AGAGGGCCCTGCAGTGCCCCCGG - Intergenic
1152963824 18:97098-97120 AGAGGGCCCTGCAGTGCCCCCGG - Intergenic
1152963858 18:97219-97241 AGAGGGCCCTGCAGTGCCCCCGG - Intergenic
1152963876 18:97280-97302 AGAGGGCCCTGCAGTGCCCCCGG - Intergenic
1152963912 18:97402-97424 AGAGGGCCCTGCAGTGCCCCCGG - Intergenic
1154145516 18:11863242-11863264 GCAGAGACTTGGAGAGCCCCCGG + Intronic
1156462045 18:37326613-37326635 ACAGCTACCTGCAGCTTCCCTGG + Intronic
1158522140 18:58180339-58180361 ACAGAGACCTGCACAGGGCCAGG - Intronic
1158931547 18:62328586-62328608 ACAGGGCCCTGGAGCGCCCATGG + Intronic
1160731286 19:642725-642747 CCAGCGACCAGCAGCACCCCAGG - Intronic
1160832711 19:1111165-1111187 CCAGAGACCAGCAGCTCCCTGGG + Intronic
1160833428 19:1113664-1113686 AGAGAGACCCGCATGGCCCCGGG - Exonic
1161556260 19:4944447-4944469 CCAGGTACCTGCAGCGTCCCGGG + Exonic
1164156555 19:22600971-22600993 ACACAGCCCTGCAGTGCCCTAGG + Intergenic
1164400625 19:27899823-27899845 ACAGAGACCCCAAGAGCCCCTGG - Intergenic
1165740730 19:38203764-38203786 ACAGACACCTGCTGAGCACCTGG - Intronic
925008950 2:467834-467856 CCAGAGACCTGCTGCACGCCGGG + Intergenic
925141226 2:1550944-1550966 ACAGAAACCTGCAGGGACCTCGG - Intergenic
925546714 2:5024555-5024577 CCAGAGACCAGCTGGGCCCCGGG + Intergenic
925594738 2:5544157-5544179 ACACAGACCAGCAGGGCCCTGGG - Intergenic
926111385 2:10186543-10186565 GCAGAGACCTGCAGGTCCACAGG + Intronic
926124871 2:10265762-10265784 GCAGAAGCCTGCAGCGGCCCCGG - Intergenic
926144874 2:10390844-10390866 ACTGTGACCTGCAGTGCCCATGG + Intronic
927713257 2:25338691-25338713 ACAGACACATGCAGCAGCCCAGG + Intronic
929172468 2:38945556-38945578 CCAGAGGCCTGCAGCGCAGCTGG - Intronic
929443605 2:41985695-41985717 AAAGAGACATGCAGAGGCCCAGG + Intergenic
931882438 2:66581642-66581664 CCAGAGCCTTGCAGAGCCCCAGG - Intergenic
938134692 2:128746365-128746387 ACAGACAGCTTCAGCGTCCCTGG + Intergenic
938211318 2:129467582-129467604 ACAGAGCCCCGCTGCGCCCCAGG - Intergenic
938671590 2:133591373-133591395 AGAGAGAGCAGCAGCTCCCCTGG - Intergenic
939045523 2:137245485-137245507 ACAGAGACCTGCCTTTCCCCTGG + Intronic
941714408 2:168748895-168748917 ATAGGCACCTGCAGTGCCCCAGG + Intronic
946361609 2:219222370-219222392 CCAGAGACCTGCAGGGCTCCAGG - Exonic
946534447 2:220610696-220610718 AAAGAAACCTGCACAGCCCCAGG - Intergenic
948040267 2:234896106-234896128 ACAGAGGCCTGAGGCCCCCCAGG + Intergenic
948476072 2:238220866-238220888 TCAGAGACCTGCAGAGACCTTGG - Intergenic
1168730992 20:80464-80486 CAGGAGACCTGCAGCTCCCCTGG - Intergenic
1168757892 20:328412-328434 GCAGAGACCTGCAGAGACCCTGG - Exonic
1169919919 20:10724203-10724225 GCAGAGCCCTGGAGCTCCCCGGG + Intergenic
1171393130 20:24814314-24814336 ACAGAGACCTGAAGCTCCCAGGG - Intergenic
1172169127 20:32918256-32918278 ACAGGGCCCTCCAGCCCCCCAGG - Intronic
1172448292 20:35004377-35004399 ACAGAAACCTGCTGGGCACCAGG + Intronic
1173753026 20:45491704-45491726 ACACAGACCTGCAGCGTGCAAGG + Intergenic
1173812386 20:45963931-45963953 ACAGAGCCCTCCAGAGCCACAGG - Exonic
1173994101 20:47324607-47324629 ATGAAGACCTGCAGTGCCCCTGG + Intronic
1175267131 20:57709734-57709756 ACTGAGCCCCGCGGCGCCCCGGG - Exonic
1175854569 20:62113593-62113615 ACTGAGCCTTGCAGCCCCCCTGG - Intergenic
1176120252 20:63451267-63451289 ACAGTCACCTGCAGCAGCCCAGG + Intronic
1176216728 20:63951611-63951633 GCAGGGACCTGCAGCCACCCAGG + Intronic
1176308358 21:5136169-5136191 AGAGAGCCCTGCAGTGCCCCAGG + Intronic
1177844941 21:26278546-26278568 GCAGAGACCTGGTGCCCCCCGGG - Intergenic
1178724075 21:35035803-35035825 AGAGAGACCTGCAGTGAGCCTGG - Intronic
1178790644 21:35696894-35696916 GCAGCCACCTGCAGCGACCCTGG - Intronic
1179848702 21:44125863-44125885 AGAGAGCCCTGCAGTGCCCCAGG - Intronic
1180859428 22:19068797-19068819 ACTGAGACCTGCTGCACACCAGG - Intronic
1180977296 22:19855329-19855351 CCCGACACCTGCAGCCCCCCAGG - Intergenic
1181064464 22:20299071-20299093 ACAGAGGTCTGCAGCGCGCGGGG + Intergenic
1181897838 22:26126394-26126416 GCAGAGAGCTGCCTCGCCCCAGG - Intergenic
1182125905 22:27815738-27815760 ACACAGCCCTGCATGGCCCCAGG + Intergenic
1184174166 22:42777329-42777351 ACAGAGACCTGCAGGCCCAGCGG + Intergenic
1184433898 22:44458505-44458527 GCAGAGCCCTGCAGCTGCCCTGG - Intergenic
1184771435 22:46599001-46599023 TCAGTGCCCTGCAGCACCCCCGG + Intronic
1184896653 22:47411225-47411247 GCAGATACCTGCAGGGGCCCCGG + Intergenic
1185070774 22:48654515-48654537 ACAGAGAGCTGCAGGGTCCTGGG + Intronic
1185369589 22:50454888-50454910 ACACAGACCTGCACGGCACCTGG + Exonic
950191578 3:10980317-10980339 AGAGAAACCTGCAGAGCCCTTGG - Intergenic
951163151 3:19451247-19451269 ACAGAGACCTGAGGCAGCCCCGG - Exonic
951491015 3:23270500-23270522 AACGAGCCCTGCAGGGCCCCAGG - Intronic
954079988 3:48207918-48207940 ACAAAGACTTGCAACCCCCCGGG - Intergenic
954397979 3:50303097-50303119 ACATTGACCTGCAGGGCTCCAGG + Exonic
954409847 3:50365681-50365703 ACAGGGACCTGCAGCGCACGGGG + Exonic
955365475 3:58306531-58306553 ACAGAGGCCCTCAGCGCCCGGGG - Intronic
956245378 3:67176591-67176613 ACAGAGGCCTACAGAGGCCCTGG + Intergenic
959873979 3:111360389-111360411 ACTGAGCCCTGCAGAGACCCCGG + Intronic
961569673 3:127788715-127788737 ACAGAGTAATGCAGGGCCCCAGG - Intronic
963028232 3:140941583-140941605 CCTGAGACCTGGGGCGCCCCTGG - Intergenic
965049475 3:163626970-163626992 ACTGAGACCAGCAGAGCCACAGG + Intergenic
965317704 3:167211815-167211837 ACAGAGATCTGAACTGCCCCTGG + Intergenic
967805125 3:193708992-193709014 ACTGCGACCTGCAGGGCCCAGGG - Intergenic
974923098 4:68266526-68266548 ACTGCGACCTCCAGCCCCCCGGG + Intergenic
976679896 4:87745325-87745347 TCAGAGACCTGCAGAGGCGCTGG - Intergenic
978540869 4:109815404-109815426 ACAGAAACCTGCCCCGCCTCTGG + Intergenic
979349219 4:119627086-119627108 CCCGAGACCCGCCGCGCCCCCGG + Intronic
985014948 4:185623938-185623960 ACAAGGACCTGCTGCGCGCCTGG - Exonic
985589085 5:755520-755542 ACAGAGGCCTCCAGGGCCCCTGG + Intronic
985603764 5:848036-848058 ACAGAGGCCTCCAGGGCCCCTGG + Intronic
985760670 5:1747047-1747069 ACAGAGCCCCTCAGGGCCCCCGG - Intergenic
986443198 5:7798929-7798951 ACAGTGACATGCAGGGCCACAGG + Intronic
988674404 5:33416967-33416989 ACAGAGACCTGTAACACACCTGG + Intergenic
997369240 5:133347200-133347222 ACAGAGACCTACACAGCCACAGG - Intronic
997599805 5:135131543-135131565 ACAGAGAGCTGCAGCACAGCAGG - Intronic
1001665261 5:173428050-173428072 AGAGAGACCTTCAGGGCCTCTGG - Intergenic
1002096565 5:176834763-176834785 TCAGACTCCTGCAGCGACCCAGG - Intronic
1002360609 5:178667767-178667789 GCAGAGACCTGCAGCAGCTCAGG + Intergenic
1003540848 6:7016833-7016855 ACAGAGTCCTCCAGGGCCCGGGG + Intergenic
1009964857 6:70567165-70567187 GCAGGTTCCTGCAGCGCCCCGGG + Intronic
1015626197 6:135182462-135182484 ACAGAGGCCGGCAGCACCCAAGG + Intronic
1017810624 6:157981483-157981505 ACAGGGAGGCGCAGCGCCCCCGG + Intergenic
1019189719 6:170244824-170244846 ACACAGAACTGCAGTTCCCCTGG + Intergenic
1019303756 7:322628-322650 ACAGTGACCTGCTCAGCCCCTGG + Intergenic
1019456565 7:1130674-1130696 AAAGTGTCCTGCAGAGCCCCAGG + Intronic
1019552192 7:1608547-1608569 GGAAAGACCTGCAGCTCCCCAGG - Intergenic
1019593745 7:1848768-1848790 ACAGTCACCTCCAGGGCCCCTGG - Exonic
1019983933 7:4641748-4641770 ACAGAGCCCGGCCCCGCCCCGGG + Intergenic
1021777560 7:24068440-24068462 ACACAGAACTGCAAGGCCCCAGG - Intergenic
1023964166 7:44953398-44953420 ACAGAGACCTGAGGTGGCCCTGG + Intergenic
1024201182 7:47107533-47107555 ACATAGACCTGCAGTCCACCTGG + Intergenic
1025092976 7:56078349-56078371 ATAGAGCCCTGCAGCCCCACCGG - Intronic
1026970286 7:74463619-74463641 ACAGAGCCCTGGAGGGCCCCAGG + Intronic
1029519156 7:101049165-101049187 CCAGAGACCTGCTCCACCCCAGG - Intronic
1031425809 7:121604382-121604404 ACAGTGACCTTCTGTGCCCCTGG - Intergenic
1032215192 7:129952396-129952418 ACAGTGGCCTGGAGTGCCCCAGG + Intronic
1034011531 7:147534240-147534262 ACAAAGCACTGCAGAGCCCCTGG + Intronic
1035254848 7:157619700-157619722 ACACAGGTCTGCAGTGCCCCAGG + Intronic
1035740566 8:1925211-1925233 GCAAAGACCTGCAGCTCCACAGG - Intronic
1037459600 8:19095579-19095601 ATGAAGACCTGCAGCGGCCCAGG + Intergenic
1038581652 8:28753411-28753433 ACAGTGGCCTGCAGAGCCCTGGG - Exonic
1041030669 8:53732820-53732842 ACAGAGGCCAGCAGCCCCCCAGG + Intronic
1041200700 8:55450438-55450460 ACAGAGACCTGCAAGGCAGCTGG + Intronic
1041687842 8:60660664-60660686 ACAGAGCCCTCCAGCTGCCCGGG - Intergenic
1043478434 8:80627952-80627974 ACTGAGACCTGGAGGGCCTCTGG + Intergenic
1043495687 8:80797616-80797638 GCAGAGACCTGCAAGGACCCTGG + Intronic
1043950054 8:86298820-86298842 ACAGAGACCAGCAGGGACACAGG - Intronic
1044164691 8:88967474-88967496 ACAGAGACTTGAAGCAGCCCTGG - Intergenic
1047474510 8:125213755-125213777 ACAGAGACCTGGAGGTCGCCAGG + Intronic
1048613810 8:136052653-136052675 AGAGAGACCTGAGGAGCCCCAGG + Intergenic
1048758597 8:137766899-137766921 ACAGAGAGCAGCAGGGCCCTGGG - Intergenic
1049420328 8:142513605-142513627 ACAGAGGTCTGCAGCCGCCCAGG + Intronic
1057298196 9:93861361-93861383 TGAGAGCCCTGCAGAGCCCCAGG - Intergenic
1058288600 9:103210173-103210195 ACACAGAGCAGCAGGGCCCCAGG + Intergenic
1058842324 9:108922074-108922096 ACAGAGATCTGTAATGCCCCTGG + Intronic
1059860670 9:118457547-118457569 AGAGGGACCTGGAGAGCCCCAGG - Intergenic
1061149892 9:128822700-128822722 CAAGTGACCTGCAGAGCCCCTGG + Exonic
1061263816 9:129494345-129494367 ACAGGGAACTCCAGGGCCCCAGG - Intergenic
1061374069 9:130213927-130213949 ACAGGGACCTCCAGAGACCCTGG - Intronic
1061927855 9:133814861-133814883 TGAGAGACCTGCAGCAGCCCGGG - Intronic
1061971805 9:134049202-134049224 AGAGAGACCTGCACACCCCCAGG - Intronic
1062116429 9:134811585-134811607 ACAGTTACCTGCAGCCCCACTGG - Exonic
1062197249 9:135281232-135281254 TCAGAGACCCCCAGCGCCACTGG - Intergenic
1062488933 9:136795028-136795050 ACAGAGACATGCAGAGGTCCTGG - Intronic
1062734202 9:138126384-138126406 AGAGGGCCCTGCAGTGCCCCCGG + Intergenic
1062734220 9:138126445-138126467 AGAGGGCCCTGCAGTGCCCCCGG + Intergenic
1062734238 9:138126506-138126528 AGAGGGCCCTGCAGTGCCCCCGG + Intergenic
1062734275 9:138126628-138126650 AGAGGGCCCTGCAGTGCCCCCGG + Intergenic
1062734342 9:138126869-138126891 AGAGGGCCCTGCAGTGCCCCCGG + Intergenic
1062734377 9:138126990-138127012 AGAGGGCCCTGCAGTGCCCCCGG + Intergenic
1189301251 X:39954159-39954181 TCAGAGACCTGCACTGCACCGGG + Intergenic
1189653181 X:43211686-43211708 ACAGAGACCTGCCACTGCCCTGG + Intergenic
1193939863 X:87668981-87669003 ATAGAGACCTGCAGAGGCCCAGG + Intronic
1193963320 X:87951988-87952010 CCAGAGACCTGCAGGAACCCTGG + Intergenic
1197510173 X:127361420-127361442 CCAGAGCCCTGCAGAGCCACAGG - Intergenic
1199603296 X:149556352-149556374 ACAGAGAGCAGCAGGGCCCCAGG - Intergenic
1199647092 X:149923123-149923145 ACAGAGAGCAGCAGGGCCCCAGG + Intergenic
1200732882 Y:6761405-6761427 ACAGGCTCCTGCAGCTCCCCAGG + Intergenic