ID: 1064271820

View in Genome Browser
Species Human (GRCh38)
Location 10:13872218-13872240
Sequence GGTCTCCTGTGGCTCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064271811_1064271820 12 Left 1064271811 10:13872183-13872205 CCGGGGGCGCTGCAGGTCTCTGT 0: 1
1: 0
2: 0
3: 25
4: 230
Right 1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG No data
1064271810_1064271820 13 Left 1064271810 10:13872182-13872204 CCCGGGGGCGCTGCAGGTCTCTG 0: 1
1: 0
2: 0
3: 32
4: 328
Right 1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG No data
1064271808_1064271820 25 Left 1064271808 10:13872170-13872192 CCTATAGGAAGGCCCGGGGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1064271820 10:13872218-13872240 GGTCTCCTGTGGCTCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064271820 Original CRISPR GGTCTCCTGTGGCTCTGGAT GGG Intronic
No off target data available for this crispr