ID: 1064271906 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:13872889-13872911 |
| Sequence | AAGGATAGTTAGATGGAGCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064271902_1064271906 | 24 | Left | 1064271902 | 10:13872842-13872864 | CCTTTTCTTTTGTTTTGATGACT | 0: 1 1: 0 2: 2 3: 68 4: 975 |
||
| Right | 1064271906 | 10:13872889-13872911 | AAGGATAGTTAGATGGAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064271906 | Original CRISPR | AAGGATAGTTAGATGGAGCC TGG | Intronic | ||
| No off target data available for this crispr | |||||