ID: 1064271906

View in Genome Browser
Species Human (GRCh38)
Location 10:13872889-13872911
Sequence AAGGATAGTTAGATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064271902_1064271906 24 Left 1064271902 10:13872842-13872864 CCTTTTCTTTTGTTTTGATGACT 0: 1
1: 0
2: 2
3: 68
4: 975
Right 1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064271906 Original CRISPR AAGGATAGTTAGATGGAGCC TGG Intronic
No off target data available for this crispr