ID: 1064274115

View in Genome Browser
Species Human (GRCh38)
Location 10:13891386-13891408
Sequence CACACACACCTACTTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064274115_1064274121 -9 Left 1064274115 10:13891386-13891408 CCCAAGGAAAGTAGGTGTGTGTG 0: 1
1: 0
2: 3
3: 30
4: 319
Right 1064274121 10:13891400-13891422 GTGTGTGTGTGCCGAGGGGAGGG No data
1064274115_1064274124 26 Left 1064274115 10:13891386-13891408 CCCAAGGAAAGTAGGTGTGTGTG 0: 1
1: 0
2: 3
3: 30
4: 319
Right 1064274124 10:13891435-13891457 GCACAGTATGTGCCCCACGTGGG No data
1064274115_1064274120 -10 Left 1064274115 10:13891386-13891408 CCCAAGGAAAGTAGGTGTGTGTG 0: 1
1: 0
2: 3
3: 30
4: 319
Right 1064274120 10:13891399-13891421 GGTGTGTGTGTGCCGAGGGGAGG No data
1064274115_1064274123 25 Left 1064274115 10:13891386-13891408 CCCAAGGAAAGTAGGTGTGTGTG 0: 1
1: 0
2: 3
3: 30
4: 319
Right 1064274123 10:13891434-13891456 AGCACAGTATGTGCCCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064274115 Original CRISPR CACACACACCTACTTTCCTT GGG (reversed) Intronic
902623885 1:17665728-17665750 CACACTCACATACGTTCCATTGG - Intronic
903300761 1:22377042-22377064 TACACACACCAAGTTTCCTTGGG + Intergenic
903658828 1:24964808-24964830 AACAGAAACTTACTTTCCTTGGG - Exonic
905336778 1:37250024-37250046 AAGACCCACCTACATTCCTTGGG + Intergenic
905526550 1:38644443-38644465 CACACACACACACTTTCCTATGG + Intergenic
906839725 1:49123695-49123717 CACTCTCTCCTACTCTCCTTGGG + Intronic
908770817 1:67593960-67593982 CACACAGAGCTTGTTTCCTTAGG + Intergenic
910690432 1:89959901-89959923 CACACACCCCTACAATCCTGAGG + Intergenic
911199109 1:95026454-95026476 CACACACACACACATTCCTTGGG - Intronic
911890234 1:103359621-103359643 CACACACTCATGATTTCCTTGGG - Intergenic
911950944 1:104172695-104172717 CACACACACCTGCACTCCTCAGG - Intergenic
912269522 1:108194678-108194700 CACACAGACCTACTTACTATAGG + Intronic
913092781 1:115491002-115491024 CACACACACATATTTCCCCTAGG - Intergenic
913728815 1:121686593-121686615 CACAGAGATGTACTTTCCTTTGG - Intergenic
913748233 1:121931156-121931178 CACAGAGATGTACTTTCCTTTGG - Intergenic
913748384 1:121933021-121933043 CACAGAGATGTACTTTCCTTTGG - Intergenic
914411931 1:147437776-147437798 CATATACACTTACTTTTCTTGGG + Intergenic
915284768 1:154845689-154845711 CACACACACACACTTCCCTAGGG + Intronic
915690891 1:157689789-157689811 GACACCCACCTGGTTTCCTTCGG + Exonic
919037499 1:192333291-192333313 CACACACACACACTTACCATAGG + Intronic
919267934 1:195296845-195296867 CACACACACCAAGTTTTCTGGGG + Intergenic
920295184 1:204951814-204951836 GACACCCACCTTCTTTCCTGCGG + Intronic
921515405 1:216085505-216085527 CACAGCCACCTCCTTTCCTATGG + Intronic
922898844 1:229121047-229121069 AACCCACACCCCCTTTCCTTGGG + Intergenic
923065922 1:230517306-230517328 CACACACACCTTCTTTCCTCCGG - Intergenic
923904974 1:238374187-238374209 CACACACACGTTCTTTTCTTTGG - Intergenic
1063922421 10:10945741-10945763 CCCACACACCTAATGTCCTGGGG + Intergenic
1064274115 10:13891386-13891408 CACACACACCTACTTTCCTTGGG - Intronic
1065638639 10:27757088-27757110 CACACACACACACTGTCATTTGG - Intergenic
1066028487 10:31391219-31391241 CACACACACAAACTTACCTGTGG - Intronic
1066734983 10:38466681-38466703 CACACACATCTATGTTGCTTAGG + Intergenic
1068008421 10:51417986-51418008 CAAACACAACTGCTTTCTTTTGG - Intronic
1068510679 10:57962099-57962121 GACACAAACCTCCTTTCCTCTGG + Intergenic
1069583268 10:69579314-69579336 CACACACACAAAATTTCCTTGGG + Intergenic
1069698536 10:70405174-70405196 CACCCCCACCTACTTTCCCTTGG - Intronic
1070127342 10:73632938-73632960 CACACAGACCTCCTCTCCATGGG + Intronic
1070772706 10:79091694-79091716 CAGGCACACCTCCCTTCCTTTGG - Intronic
1072904426 10:99439233-99439255 CACACATACATACTTTGCTTTGG - Intergenic
1073106575 10:101035818-101035840 CAAACACACCTACTGTCTCTGGG - Intronic
1073566766 10:104541860-104541882 AAGCCACACGTACTTTCCTTTGG + Intergenic
1075118940 10:119650886-119650908 CAAACTCACCTGCCTTCCTTTGG - Intergenic
1075905261 10:126075653-126075675 CACTCACACCTTCTTCCCTTCGG - Intronic
1077052055 11:571403-571425 CACAGACACCTGCCTTCCCTAGG + Intergenic
1078646353 11:13144192-13144214 CACACACACCTCCTTTCTATTGG - Intergenic
1079143174 11:17827569-17827591 CACAATCTCCTACTTGCCTTGGG + Intronic
1079209426 11:18448107-18448129 CACACACCCCTTCTTTTCTGAGG + Intronic
1080210348 11:29778831-29778853 TGCACACACATACATTCCTTTGG + Intergenic
1080570396 11:33551089-33551111 CAAATACACCAACTTCCCTTTGG - Exonic
1082974153 11:59055622-59055644 CACACCCTCCTGCTATCCTTTGG + Intergenic
1083095009 11:60241676-60241698 AACACACGCTTTCTTTCCTTGGG - Intronic
1083640701 11:64143791-64143813 CACACACACACAATTTCCTGGGG + Intronic
1083983352 11:66192487-66192509 CAGCCACACTAACTTTCCTTTGG - Intronic
1085992469 11:81866372-81866394 CACACGCACCTATGTTCCTAGGG - Intergenic
1086010237 11:82094112-82094134 CACACACACCCCTTTTCCCTAGG + Intergenic
1086435782 11:86779924-86779946 AACAGAGACCTCCTTTCCTTTGG + Intergenic
1086969171 11:93061860-93061882 CAAAGACACCTGCTTTCCATGGG - Intergenic
1087552674 11:99671915-99671937 CACACACACCTGGTTTGCTGAGG + Intronic
1088366689 11:109047302-109047324 CACACACACACACTCTTCTTGGG - Intergenic
1088579765 11:111303258-111303280 GACACACACACACTTGCCTTTGG + Intronic
1088735088 11:112722153-112722175 CACACACACTTACTTTGTCTAGG - Intergenic
1090700305 11:129288864-129288886 CACACACACGTACATACCTATGG - Intergenic
1091420081 12:330043-330065 CACACACACACTTTTTCCTTTGG - Intronic
1092835765 12:12486472-12486494 CACACACACACACTCTCATTTGG - Intronic
1093089226 12:14903089-14903111 CACACACACACACTTTCTTAGGG + Intronic
1095191980 12:39268909-39268931 CAAACACACATATTTTTCTTTGG - Intergenic
1095796066 12:46219966-46219988 CACACACCCCTACCTTTCTGGGG + Intronic
1096162418 12:49390084-49390106 CCGACACATCTTCTTTCCTTAGG - Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096552999 12:52385805-52385827 CAGACACACCTAGTCTCATTGGG + Intergenic
1097401258 12:59130870-59130892 CACACACACACACTTACTTTGGG - Intergenic
1098953561 12:76666055-76666077 CACACACACACACTTTCCTGGGG - Intergenic
1100563653 12:95773619-95773641 AACTCACCTCTACTTTCCTTTGG + Intronic
1102689951 12:114752658-114752680 CTCACACACACACTATCCTTTGG + Intergenic
1106724299 13:32468912-32468934 CACACACAGCTGCATTCCCTGGG - Intronic
1106873501 13:34046947-34046969 AACACACATGTACTTTCCCTAGG - Intergenic
1107445950 13:40470555-40470577 CACAGTCACCTGCCTTCCTTGGG - Intergenic
1107882704 13:44846519-44846541 CACACACACACACTTTTTTTAGG + Intergenic
1109090702 13:58041115-58041137 CACACACACACACTTTTCTTGGG - Intergenic
1109971036 13:69769686-69769708 CACACACAGCTACCCTCTTTGGG + Intronic
1110476918 13:75927072-75927094 CACACACACACACACTCCTTGGG - Intergenic
1111743118 13:92229841-92229863 CACCTACACCAACTTGCCTTTGG - Intronic
1113156479 13:107328303-107328325 CACACACACACACTTTTGTTTGG + Intronic
1113330797 13:109325287-109325309 CACACACACACACATTCTTTTGG + Intergenic
1113428583 13:110230148-110230170 CACACACACGCACTTTCTTCAGG - Intronic
1113485182 13:110647655-110647677 CACACACAGGCACTTTCCCTCGG - Intronic
1113904233 13:113811852-113811874 CGCACCCACCTACTTTCCCCCGG + Exonic
1114793196 14:25682137-25682159 CACACACACACACTTTCTATTGG - Intergenic
1115180339 14:30618492-30618514 CACACACACATACTTTGTTGGGG + Exonic
1115214443 14:31000909-31000931 CACACACATCCCCTTTTCTTAGG - Intronic
1116399381 14:44486880-44486902 CACACACACATACATTCAGTTGG + Intergenic
1122131657 14:99607396-99607418 GACTCACAGCTACTTTCCCTGGG - Intergenic
1123921036 15:25070006-25070028 CTCACACACCTACTTTTCCTTGG - Intergenic
1123922240 15:25078499-25078521 CACAAAGAACAACTTTCCTTCGG - Intergenic
1124157501 15:27239049-27239071 AACACACACCTAGTTTACTATGG - Intronic
1125030620 15:35072277-35072299 TAACCACACCTACTTTCCTCCGG + Intergenic
1125181300 15:36883160-36883182 CACACACACGTCTTTTCCATGGG - Intergenic
1125764174 15:42122024-42122046 CACACACACATATTATCCCTGGG + Intergenic
1127259855 15:57319760-57319782 CAGCCACACCCACTTTGCTTTGG - Intergenic
1127305219 15:57699011-57699033 TACATACACCGAGTTTCCTTAGG + Intronic
1128519399 15:68365503-68365525 CAGACTCACTTCCTTTCCTTCGG - Intronic
1129606958 15:77029630-77029652 CACACACACCTCCTCACCCTGGG + Intronic
1130126069 15:81095032-81095054 AAAACACACCTAATTTCTTTTGG + Intronic
1130344221 15:83026956-83026978 CACACACACGTATTTCCCCTAGG - Intronic
1132854519 16:2038811-2038833 CTCACACACCTACGTTCCCCAGG - Exonic
1134155624 16:11840812-11840834 CTCATACACCTACATTCGTTGGG - Intronic
1135191774 16:20360310-20360332 AACACACAGCTCCTTGCCTTGGG - Intronic
1135918156 16:26624542-26624564 CACACACACACACTCTCCTGTGG + Intergenic
1136068532 16:27774749-27774771 CAGACACACCTGCTCCCCTTGGG + Intronic
1137316843 16:47334269-47334291 CACACCCAGCTAACTTCCTTTGG - Intronic
1137373823 16:47933369-47933391 CACACAGACCTACCTTGCTTGGG + Intergenic
1140288631 16:73628943-73628965 CACACACCCCTTCTTTCCAAGGG - Intergenic
1141050924 16:80762853-80762875 AACACACACATTCTGTCCTTAGG - Intronic
1141108363 16:81252097-81252119 TCCAGACACCTACTTTCCTGTGG + Intronic
1141386315 16:83625142-83625164 CACACACACAGAGTTTCTTTAGG - Intronic
1141799980 16:86300933-86300955 AACACAGACCTACCTTCCTTTGG - Intergenic
1142452462 16:90186712-90186734 CACACACATCTACGTTGCTGAGG + Intergenic
1143255403 17:5553998-5554020 CAGACACACCTGTGTTCCTTTGG + Intronic
1143476787 17:7207819-7207841 CACACACACATTCTTGCTTTAGG + Intronic
1143576964 17:7799358-7799380 CTCACCCATCTCCTTTCCTTAGG + Intronic
1144666203 17:17103970-17103992 CACACAGAGTTCCTTTCCTTTGG - Intronic
1145421262 17:22833635-22833657 CACAGAGAAGTACTTTCCTTGGG + Intergenic
1145422832 17:22855046-22855068 CACAGAGCACTACTTTCCTTGGG + Intergenic
1145434668 17:23018019-23018041 CACAGAGCACTACTTTCCTTGGG + Intergenic
1145436028 17:23037053-23037075 CACAGAGCACTACTTTCCTTGGG + Intergenic
1145446883 17:23186971-23186993 CACAGAGCACTACTTTCCTTGGG + Intergenic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147446873 17:40479969-40479991 CCCACACACCCACTTTCTGTTGG - Intronic
1147725791 17:42565465-42565487 CACACACACACGCTTTCCTGTGG - Exonic
1148227354 17:45908271-45908293 CACACACACATGCTTTCCGGAGG + Intronic
1148332607 17:46821266-46821288 CACACACACCTCCATTCACTAGG - Intronic
1149073173 17:52567963-52567985 CATACATACATACATTCCTTTGG - Intergenic
1149170035 17:53798689-53798711 GATACACACATACTTACCTTTGG + Intergenic
1149481687 17:57008621-57008643 CCCACACCCCTACCTTCCTAGGG + Intergenic
1151571312 17:74927216-74927238 CATACAGACCTACTTTCTCTGGG + Exonic
1151765848 17:76132770-76132792 CACCTACACCTATTTACCTTTGG + Intergenic
1152605445 17:81287310-81287332 CACACAGACTGACTTTCCCTGGG - Intronic
1152783038 17:82234827-82234849 CACCCCCACCCCCTTTCCTTGGG - Exonic
1155023914 18:21923572-21923594 CACACACACCTACTTGGCTGAGG - Intergenic
1155920620 18:31599556-31599578 CCCACACACCCAATTTACTTAGG + Intergenic
1156881310 18:42084083-42084105 CACATATTCATACTTTCCTTGGG + Exonic
1156977422 18:43239436-43239458 CACACACACACACATTCCCTTGG + Intergenic
1159989306 18:74883662-74883684 AACACACACCCACATTCTTTTGG - Intronic
1160303508 18:77708467-77708489 CACACTCATCTCATTTCCTTTGG - Intergenic
1160339995 18:78081500-78081522 CTAACACACCTACTTTCAGTTGG + Intergenic
1160560838 18:79754937-79754959 CACACACTCCTGCTTTCCGACGG + Exonic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1163330439 19:16633526-16633548 CGCACACACTTAATTTACTTTGG - Intronic
1164538471 19:29104997-29105019 CACACACACGCACTGTCCTATGG + Intergenic
1165037034 19:33041209-33041231 CCAACAGATCTACTTTCCTTTGG + Intronic
1165545878 19:36535479-36535501 AACACCCACCTCCTTTCCTCAGG + Intronic
1167551689 19:50165648-50165670 CACCCACGCCTACCTTTCTTAGG + Intergenic
1167863942 19:52308714-52308736 CACAGAGACCGATTTTCCTTTGG + Intronic
1168447949 19:56438869-56438891 CACAGTCACCTAATTTCCTCAGG - Intergenic
925521509 2:4751248-4751270 CACAAACTCATACTTTGCTTCGG + Intergenic
930103950 2:47625532-47625554 CACACTGACTTCCTTTCCTTTGG + Intergenic
930876119 2:56219138-56219160 CACACACACTTCCTTTTCCTGGG + Intronic
931590827 2:63881366-63881388 CACACACACACACGTTCCTACGG + Intronic
931836514 2:66104783-66104805 GACCCACACCTCATTTCCTTTGG + Intergenic
932017273 2:68043939-68043961 CACACACACCAACCTGCCTTGGG + Intronic
933006441 2:77001446-77001468 CACATGCACATACTTGCCTTAGG - Intronic
933294629 2:80475006-80475028 CACAGACACCTCATTTGCTTAGG - Intronic
933506906 2:83188257-83188279 CACACACACATACTTTTTTAAGG - Intergenic
933558209 2:83858253-83858275 CACACACACACACTTTTTTTGGG - Intergenic
933727165 2:85433549-85433571 CACACACCCCTCCCTACCTTAGG + Intronic
935214206 2:100963267-100963289 GAGACACCCCTACTTTCCCTGGG + Intronic
935788349 2:106569184-106569206 CACACACACCCTCTTTCCAATGG - Intergenic
936165734 2:110117579-110117601 CACACACACACACATTGCTTTGG - Intergenic
936549316 2:113421693-113421715 CACACAAGGCTACTTTCATTGGG - Intergenic
937333108 2:121044387-121044409 CACTCACACATTCCTTCCTTTGG + Intergenic
937717937 2:125056341-125056363 CACACACACATCCTGTCATTTGG + Intergenic
937761991 2:125615851-125615873 CACACACACATACATACCATGGG + Intergenic
938721881 2:134074787-134074809 CACACCCACTAACATTCCTTTGG + Intergenic
938998298 2:136703990-136704012 CTCAAACCCCTACTTTCCTGAGG + Intergenic
939293609 2:140226261-140226283 CACAAACACCTACAATTCTTAGG - Intergenic
939878746 2:147606279-147606301 TACAGAAGCCTACTTTCCTTTGG + Intergenic
940173014 2:150849294-150849316 CACACACACTCACATTCCTCTGG + Intergenic
940781278 2:157936767-157936789 TATACATACCTTCTTTCCTTAGG + Intronic
941348087 2:164395179-164395201 CAAACATATCTACTTTCCTGTGG + Intergenic
943721937 2:191213760-191213782 CACACACTCCCACTCTCCATGGG - Intergenic
944883704 2:204041638-204041660 CACACACACAAAGTGTCCTTAGG - Intergenic
946093923 2:217255702-217255724 CATACAGACCTCATTTCCTTTGG + Intergenic
947941580 2:234060786-234060808 CACACACACTTGATTTCCCTGGG + Intronic
948819578 2:240533744-240533766 CACACACACACACTTTTTTTAGG + Intronic
1170318022 20:15063637-15063659 CACACACTCATACATTCCCTAGG - Intronic
1172026001 20:31949172-31949194 CTCACACTCTCACTTTCCTTAGG - Intronic
1172195928 20:33091468-33091490 CACACATATGTACTTTCCCTAGG + Intronic
1172434522 20:34919567-34919589 CACACACACACACTTGCCTTGGG - Exonic
1173489315 20:43466891-43466913 CACACACACCCGCTTTCTCTAGG - Intergenic
1174131947 20:48351317-48351339 CACACACACCCATTTTCCACTGG + Intergenic
1174629862 20:51946803-51946825 CACACACACCCATGTTCCCTTGG - Intergenic
1174975572 20:55329299-55329321 CACACACACATTCCTTCCCTGGG - Intergenic
1175704571 20:61167035-61167057 CACACACATTTATTTTCCCTTGG - Intergenic
1176570069 21:8405561-8405583 CACACACACATACCTACCTACGG - Intergenic
1176577980 21:8449768-8449790 CACACACACATACCTACCTACGG - Intergenic
1178635028 21:34294950-34294972 CACACACACCCACTTGCCGGGGG - Intergenic
1178817075 21:35941186-35941208 CACACACACACAGATTCCTTTGG - Intronic
1179033925 21:37743798-37743820 TACAAACACCTACTTTCCATGGG + Intronic
1180567937 22:16691156-16691178 CACACACACATGCTTTTTTTGGG - Intergenic
1181309369 22:21936014-21936036 CACACACAGCTAATTTTTTTTGG - Intronic
1181854894 22:25774636-25774658 CACAGCCACCTCCTGTCCTTAGG + Intronic
1203256185 22_KI270733v1_random:139519-139541 CACACACACATACCTACCTACGG - Intergenic
950463960 3:13142352-13142374 CAGACACAGCCCCTTTCCTTTGG + Intergenic
950501313 3:13365656-13365678 CCCACACTCCTACCTTCGTTGGG + Intronic
951543151 3:23802077-23802099 CCCCCACCCCTAATTTCCTTTGG - Intergenic
951893685 3:27590092-27590114 CCCACACACCTCCTTTGCTCAGG - Intergenic
952087924 3:29849162-29849184 CACACACACACACATTCCTTTGG - Intronic
953899085 3:46828952-46828974 CACATGCACCTTCTTTCCATAGG + Intergenic
954398314 3:50304816-50304838 CACTCACACCTACTTGCCACTGG - Intronic
955034804 3:55257079-55257101 CACTTACAACTGCTTTCCTTAGG + Intergenic
956515269 3:70039632-70039654 CACACACACACACTTTCTATTGG + Intergenic
956578277 3:70780508-70780530 CACACACACTTACTCTGATTGGG + Intergenic
956641816 3:71422887-71422909 CACACACCCCTTCTTTCATATGG + Intronic
957352017 3:79036698-79036720 CACAGAGACCTTCTTTACTTTGG - Intronic
957898844 3:86461817-86461839 AACACACACTTATTTTTCTTAGG + Intergenic
959663625 3:108897134-108897156 CACACACACCTTCTTTGTCTTGG - Intergenic
959847608 3:111052788-111052810 CACACACAAGCACTTTCCATAGG + Intergenic
961214801 3:125150973-125150995 CACACACACCAAGTTTCCTCAGG + Intronic
961357446 3:126348008-126348030 CACACTCACCTACTCCCCGTGGG - Intronic
961764310 3:129196935-129196957 AATACACAGCTAGTTTCCTTGGG + Intergenic
963257965 3:143164813-143164835 CACACACACTTACTTCGCATAGG - Intergenic
964492991 3:157256911-157256933 CCAACTCACCTACTTTCCATAGG - Intergenic
965687320 3:171317948-171317970 CACACACGTTTCCTTTCCTTAGG - Intronic
967201052 3:187072942-187072964 CACGGACACCCACTTACCTTTGG - Exonic
969280786 4:6169593-6169615 CACACACACACAATTTCCTAGGG - Intronic
970022626 4:11586337-11586359 CACACACACCCACTTTCAGGAGG + Intergenic
971197337 4:24482044-24482066 CACACACACACAGGTTCCTTAGG - Intergenic
971832033 4:31706858-31706880 CACACACACACACATTCCTTTGG + Intergenic
973536214 4:51884954-51884976 CAGAAACACCTACTTACCTGTGG - Intronic
973748667 4:53989704-53989726 CACACACACATTCTTACATTAGG + Intronic
973757894 4:54093265-54093287 CACACCCACCTGCTTTGCATAGG - Intronic
974798740 4:66786103-66786125 CACACACATTTACTTCCCCTAGG + Intergenic
975742133 4:77439692-77439714 CACAGATAACCACTTTCCTTTGG + Intergenic
977233405 4:94478865-94478887 CAAGCACACCTACCTTCTTTTGG - Intronic
977878481 4:102177021-102177043 CACACACACATACTTAACATTGG - Intergenic
978511273 4:109521552-109521574 CAGACACAGTTACCTTCCTTGGG + Exonic
979261338 4:118649611-118649633 CACACACATCTATGTTGCTTAGG + Intergenic
979777632 4:124610976-124610998 CACACACATCTACTTTACTTAGG + Intergenic
980599621 4:135004481-135004503 TACAAACACCTACATTCCATTGG - Intergenic
981638602 4:146910298-146910320 CTCACATACCTAATTTCATTTGG - Intronic
984962569 4:185112033-185112055 CACACACACACACACTCCTTTGG - Intergenic
985771416 5:1814157-1814179 CACACACATCTACTTTTCACTGG - Intronic
986070829 5:4280684-4280706 CACACACACTTATCTTCCTATGG + Intergenic
987902032 5:24024529-24024551 CAGAAACACCAATTTTCCTTAGG - Intronic
988638739 5:33017409-33017431 CAATCACACCTACTGTTCTTTGG + Intergenic
990110717 5:52319900-52319922 CACACACACATTCTTCCATTTGG - Intergenic
990322961 5:54647948-54647970 CGCACACACCAGCATTCCTTCGG - Intergenic
991127884 5:63088125-63088147 GACACACACGTAATCTCCTTAGG + Intergenic
991204550 5:64035560-64035582 CACACACACCTCCTTCCCTGTGG + Intergenic
991644194 5:68784981-68785003 CATACAGACCTCCTTTCCTTTGG - Intergenic
992171304 5:74104588-74104610 CACACACACACACCTTCCTTTGG + Intergenic
993458661 5:88156377-88156399 CACACACACATCCCTACCTTCGG - Intergenic
993671380 5:90765012-90765034 CACTCCCACCTACTTTCCATGGG + Intronic
994084204 5:95740856-95740878 CACACACACACACTTTTTTTTGG + Intronic
995387029 5:111599410-111599432 CACACTCAACTAGTTTCCTCTGG - Intergenic
996443429 5:123516508-123516530 AATAAACACATACTTTCCTTAGG - Intronic
996641923 5:125765287-125765309 TACACAGATCTCCTTTCCTTTGG + Intergenic
996755682 5:126932611-126932633 CAGTAACACCTACTTTCCTTAGG - Intronic
999553176 5:152712516-152712538 CAATCATACCTACTATCCTTAGG + Intergenic
1003512447 6:6792594-6792616 CTGACACACCTACTTTACCTGGG + Intergenic
1004733215 6:18379448-18379470 CTCACTCACCTATTTTCCTAGGG - Intergenic
1008392779 6:50972235-50972257 CACACTGACCTGCTTTCCCTTGG + Intergenic
1008483771 6:52013674-52013696 CACACACACATATTTACTTTGGG + Intronic
1008620007 6:53262653-53262675 CACACAAAGCTACTTTCTTAAGG - Intergenic
1009912921 6:69955513-69955535 CACACACACACACTTTGCTGTGG - Intronic
1012003725 6:93685752-93685774 CACACACACAGACTTTGTTTGGG + Intergenic
1012021466 6:93926859-93926881 CACACACACACACTTTTCTTAGG + Intergenic
1015448006 6:133330584-133330606 CACACACACATACTTTTTTGGGG + Intronic
1015736138 6:136402074-136402096 CACACACACCTCCTTCCCCCTGG + Intronic
1015824093 6:137293612-137293634 AACACACAGCTACTTTGTTTGGG - Intergenic
1015974708 6:138778152-138778174 CCCCCTCACCTACTTTCCCTGGG + Intronic
1017488578 6:154924666-154924688 CACACACACCTCCTTTCCTCAGG + Intronic
1018171845 6:161149984-161150006 GACACATCCTTACTTTCCTTTGG - Intronic
1020492459 7:8804787-8804809 AACACACACTTACATACCTTAGG + Intergenic
1020742103 7:12033481-12033503 CACACACACACACTATCATTTGG - Intergenic
1021403824 7:20240788-20240810 CACACTGAACTACTTTCCTTCGG + Intergenic
1021461715 7:20895031-20895053 CATAGACACTTACTTTCCTGAGG - Intergenic
1021855180 7:24848169-24848191 CTCACACACCTTCACTCCTTGGG - Intronic
1021857599 7:24872439-24872461 CACACACACACACTCTCTTTCGG - Intronic
1021914049 7:25414049-25414071 AATGCACATCTACTTTCCTTCGG + Intergenic
1022355716 7:29612535-29612557 GACCCACTCCTACTTTCCTGTGG - Intergenic
1022518724 7:30992172-30992194 CACACACACACACAATCCTTAGG + Intronic
1022859189 7:34348984-34349006 CACCCACACCCACATTCATTTGG - Intergenic
1023558589 7:41449133-41449155 TACACACACCTATCTTCCATAGG - Intergenic
1023808896 7:43895844-43895866 CACACACATTTCCTTTCTTTTGG - Intronic
1024124871 7:46283374-46283396 CACACACACATCCTTGGCTTTGG - Intergenic
1027346065 7:77261040-77261062 CTCACAAACCTAGTTGCCTTTGG + Intronic
1027349344 7:77294450-77294472 CACACACACCTACCTCTCATTGG - Intronic
1028166558 7:87544508-87544530 CACAAACACTTACTTTTATTTGG + Intronic
1029371951 7:100155809-100155831 CTCACACAGCTGCTTTCCTGGGG + Exonic
1029482779 7:100823255-100823277 CTCACACCCCTACTTGTCTTCGG - Intronic
1030477406 7:110053825-110053847 CACAATGACTTACTTTCCTTTGG + Intergenic
1031092135 7:117370794-117370816 CACACACACACAATTACCTTTGG - Intronic
1031147243 7:118010373-118010395 CACACCCACCTACCTTCTTATGG - Intergenic
1031180772 7:118412182-118412204 CACACACACACACAATCCTTAGG - Intergenic
1033655973 7:143374702-143374724 CAGCCACACCTACCTGCCTTGGG + Intergenic
1035596689 8:863864-863886 CACACCAACCTCATTTCCTTGGG - Intergenic
1036114514 8:5944185-5944207 CACACACACACACTTGCATTAGG + Intergenic
1037011838 8:13853270-13853292 CACACACACACACTTTCTCTGGG - Intergenic
1037092550 8:14940491-14940513 CACACACATATATTTTACTTAGG - Intronic
1037405975 8:18542938-18542960 CACACTCAGCTTCCTTCCTTAGG + Intronic
1037627652 8:20622145-20622167 CACACACACATACCTGCCCTAGG + Intergenic
1038156757 8:24998725-24998747 CACACACCCCTACACCCCTTTGG - Intergenic
1038341173 8:26686386-26686408 CACACACACTTATTTTCTTGTGG + Intergenic
1039416313 8:37397310-37397332 CACACACACTTACCTTCTGTTGG - Intergenic
1040470996 8:47736052-47736074 CACACACACCTGTTTTAATTAGG + Exonic
1040843978 8:51815999-51816021 CACACACACACACTCTTCTTTGG - Intergenic
1044131526 8:88529667-88529689 CACACACACTCACTTTTATTGGG + Intergenic
1045735525 8:105292169-105292191 CACCCACATCTATTTTCTTTTGG - Intronic
1046417188 8:113932999-113933021 CACACACACACACCTTCTTTAGG + Intergenic
1047294858 8:123561827-123561849 TAACCACACCTCCTTTCCTTTGG + Intergenic
1049623103 8:143607856-143607878 CACACACAAACACTTTGCTTTGG + Intronic
1049903623 9:195144-195166 CACACAAGGCTACTTTCATTGGG + Intergenic
1051639399 9:19210969-19210991 CCCACACATCTACTTAACTTTGG - Intergenic
1052018629 9:23499137-23499159 TGCACATACCTGCTTTCCTTCGG + Intergenic
1053100138 9:35364623-35364645 CACACACACATACAGTGCTTGGG - Intronic
1053284640 9:36842295-36842317 CACACACACCCGCCTTCCTCTGG - Intronic
1053746633 9:41205452-41205474 CACACAAGGCTACTTTCATTGGG + Intergenic
1054480632 9:65659771-65659793 CACACAAGGCTACTTTCATTGGG - Intergenic
1054681712 9:68225828-68225850 CACACAAGGCTACTTTCATTGGG - Intergenic
1055219382 9:73909868-73909890 CACACACACACACTTGCCATTGG + Intergenic
1055576691 9:77666986-77667008 CAAACACATCTCCTTTTCTTTGG - Intergenic
1059320413 9:113464244-113464266 CTCATTCACCCACTTTCCTTTGG + Intronic
1059359592 9:113731284-113731306 CACACACACACACGGTCCTTTGG - Intergenic
1059517771 9:114911737-114911759 CTGCCCCACCTACTTTCCTTGGG + Intronic
1059919739 9:119145783-119145805 CACACACACACACTCCCCTTTGG - Intergenic
1060431847 9:123557264-123557286 CACACTCACCTGCTCTCCCTGGG - Intronic
1060561434 9:124548077-124548099 CACACACACTTACTTACCTGTGG + Intronic
1202782763 9_KI270718v1_random:16233-16255 CACACAAGGCTACTTTCATTGGG + Intergenic
1203472341 Un_GL000220v1:121226-121248 CACACACACATACCTACCTACGG - Intergenic
1186188821 X:7049113-7049135 CACGCACACATACATTCCTACGG + Intronic
1187400357 X:18954170-18954192 CACACACAGCTACTTCTCTGTGG + Intronic
1187651288 X:21410782-21410804 CACACACACACACAATCCTTTGG - Intronic
1188549181 X:31343573-31343595 CACACACACACACTCCCCTTTGG - Intronic
1188783572 X:34315107-34315129 CCCAGACACGTACTTTCCTGTGG - Intergenic
1189193458 X:39132177-39132199 CACACCCACCTACTATGTTTAGG - Intergenic
1189200487 X:39191563-39191585 CAGACACACCTCATTCCCTTGGG - Intergenic
1189621226 X:42840680-42840702 CATACACAAATACTTTCCATTGG + Intergenic
1190091963 X:47446474-47446496 CCAACACCCCTGCTTTCCTTGGG - Exonic
1190699320 X:52975081-52975103 CACACACACACACATTCCCTTGG + Intronic
1191655612 X:63595265-63595287 CTCAAACACTTACTTTTCTTTGG - Intergenic
1192046566 X:67681456-67681478 CACCCACACCATATTTCCTTTGG + Intronic
1193197745 X:78654739-78654761 CACACATACATACTTAGCTTGGG - Intergenic
1194146307 X:90269617-90269639 CACACACATATATTTTGCTTTGG + Intergenic
1194833328 X:98652364-98652386 TACACACATCTATTGTCCTTGGG + Intergenic
1197630075 X:128848324-128848346 CACACACACACACTTTTCTTGGG - Intergenic
1198429439 X:136550812-136550834 CCCAGATACCTACTTTCATTTGG - Exonic
1198480749 X:137037674-137037696 CACACACACACACATTCATTTGG - Intergenic
1198881808 X:141289828-141289850 CACATACACCTTCTCTCTTTAGG - Intergenic
1199312174 X:146333345-146333367 CACACACACACAATTTCATTTGG - Intergenic
1200492049 Y:3838823-3838845 CACACACATATATTTTGCTTTGG + Intergenic
1201704898 Y:16926223-16926245 CACACACACATAAATTCATTCGG + Intergenic
1202382809 Y:24291986-24292008 CACACACATCTATGTTGCTTAGG + Intergenic
1202487975 Y:25378139-25378161 CACACACATCTATGTTGCTTAGG - Intergenic