ID: 1064274910

View in Genome Browser
Species Human (GRCh38)
Location 10:13896862-13896884
Sequence GTAGAATCGGCTGCTCTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064274910_1064274916 30 Left 1064274910 10:13896862-13896884 CCCCGAAGAGCAGCCGATTCTAC No data
Right 1064274916 10:13896915-13896937 GTTTAATCCGTTTATGCGTGAGG No data
1064274910_1064274915 8 Left 1064274910 10:13896862-13896884 CCCCGAAGAGCAGCCGATTCTAC No data
Right 1064274915 10:13896893-13896915 ATTCAGTCAGCTACTTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064274910 Original CRISPR GTAGAATCGGCTGCTCTTCG GGG (reversed) Intronic