ID: 1064276336

View in Genome Browser
Species Human (GRCh38)
Location 10:13908750-13908772
Sequence CTGATAACTGAGTAAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064276336_1064276337 1 Left 1064276336 10:13908750-13908772 CCATGTTTTTACTCAGTTATCAG 0: 1
1: 0
2: 5
3: 22
4: 293
Right 1064276337 10:13908774-13908796 AGCATTGCCAGAGAAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064276336 Original CRISPR CTGATAACTGAGTAAAAACA TGG (reversed) Intronic
904275430 1:29380899-29380921 CGGATAACTGGGTTAACACATGG + Intergenic
905986034 1:42283336-42283358 CTCAAAACTGAGTCATAACACGG + Intronic
908051187 1:60232742-60232764 CTGATAAATGTTTAAAACCAGGG + Intergenic
909828032 1:80150506-80150528 CTGAGAACTGAAAAAAGACAAGG - Intergenic
910130236 1:83895873-83895895 GGGATCACTGTGTAAAAACAAGG + Intronic
911111159 1:94187645-94187667 CTGATAAATGGGTGAAAACCTGG - Intronic
913206531 1:116544247-116544269 CTGAAAACAGACTAAAAAAATGG + Intronic
915095415 1:153459107-153459129 CTGAGGACAGAGTAAAAACACGG + Intronic
916313036 1:163417796-163417818 CTGATAAATGAGAATCAACATGG - Intergenic
916437849 1:164793142-164793164 CTGATAAATAAGGAAAAACAAGG - Intronic
917051010 1:170923197-170923219 TTGAAAACTGTGTAAATACATGG + Intergenic
917094323 1:171384979-171385001 GTGATAAATGAGTAAGACCATGG + Intergenic
917667186 1:177236539-177236561 CTGATAATAGACTATAAACAAGG + Intronic
917794992 1:178526977-178526999 CAGAGAACTGAGCAAAGACAAGG - Intronic
919573295 1:199275513-199275535 CAGATAACTGAGTTAAAAAATGG + Intergenic
921321578 1:213945455-213945477 CTTATAAGTAACTAAAAACATGG - Intergenic
922850778 1:228731960-228731982 CTTAAAACTGAGCAAAGACATGG + Intergenic
923511039 1:234653825-234653847 CAGATAACCCAGTTAAAACATGG + Intergenic
924820576 1:247486166-247486188 TTGTTATCTGAGTAAAAATACGG + Intergenic
1063174647 10:3540370-3540392 GAGTTAACTGAGTTAAAACAGGG - Intergenic
1064276336 10:13908750-13908772 CTGATAACTGAGTAAAAACATGG - Intronic
1064820328 10:19322701-19322723 CTGAGCACTCAGTAAATACATGG + Intronic
1066197324 10:33113349-33113371 CAGATAAGTGAGCAAAACCATGG + Intergenic
1066651366 10:37658949-37658971 CTGAGAACTGAAATAAAACAAGG + Intergenic
1067912791 10:50363595-50363617 GTGGTATCTGACTAAAAACAAGG + Intronic
1068011064 10:51452355-51452377 CTGAGAACTGAAAAAAGACAAGG - Intronic
1069228873 10:65980919-65980941 CTGATAACTGGGACAAGACAAGG + Intronic
1074506625 10:114076691-114076713 CTGAAAACAGAGTAGATACATGG - Intergenic
1075428688 10:122362973-122362995 CTGATAGTTGAATAAAACCAAGG - Intergenic
1075945679 10:126431127-126431149 TTGACAACTGACCAAAAACAAGG + Intronic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1078000931 11:7495012-7495034 CTGTTAACTGAGCAAAAAGTGGG - Intronic
1078392025 11:10943582-10943604 CTAATATATGAGTAGAAACATGG - Intergenic
1078872179 11:15357851-15357873 GTGAAAACAGAGGAAAAACATGG + Intergenic
1078980699 11:16529738-16529760 CTGATACCTGAGAATGAACAAGG - Intronic
1079178434 11:18166107-18166129 CTGATAACTGAAACAAGACAAGG + Intronic
1079837986 11:25358813-25358835 CTTATAAATGAGTGAAAAAATGG + Intergenic
1079855398 11:25596590-25596612 CTGATCACTTAGTGAAAAAATGG + Intergenic
1080787531 11:35489280-35489302 CTGTTAAGTGAGTAATAAAAGGG - Intronic
1081484015 11:43514173-43514195 CTGATAGGTCAGTAAAAAGATGG - Intergenic
1081509509 11:43755548-43755570 CTGAGAAGTTAGTTAAAACAAGG - Intronic
1081521037 11:43881147-43881169 CTGTTTACTGAGGAAAAACTGGG + Exonic
1082740616 11:56906968-56906990 TTGTGAACTGAGTAAGAACATGG + Intergenic
1084467937 11:69337827-69337849 CAGATAACTCAGTAAATATATGG - Intronic
1084701393 11:70788536-70788558 CTGATATCAGACCAAAAACATGG + Intronic
1085608285 11:77922731-77922753 CTGATACCTGAGTAAAATCAGGG - Intronic
1085815151 11:79729200-79729222 TTGAAAACTATGTAAAAACATGG - Intergenic
1085850918 11:80118761-80118783 CTGAAAACTTTGTAAAGACAAGG - Intergenic
1086157112 11:83679524-83679546 TTGGAAACTTAGTAAAAACAGGG - Intronic
1086541809 11:87921790-87921812 CTGCTATCTGAGAAAAAAAAAGG - Intergenic
1087371473 11:97290637-97290659 CTGATGACTAAGTAAAACCAAGG + Intergenic
1088445108 11:109917761-109917783 ATGATCACTGAATAGAAACATGG - Intergenic
1088715024 11:112541620-112541642 CTGATAAGTAAGCAACAACAAGG + Intergenic
1090888610 11:130901962-130901984 CTGAATACTGAGTAGGAACAAGG + Intronic
1091132908 11:133161435-133161457 CTAAGAACTGAGTAATAGCATGG + Intronic
1092501752 12:9054200-9054222 ATGATAAATAAATAAAAACAAGG - Intergenic
1098025965 12:66201760-66201782 CTAATATCTGGGTAAAATCAGGG - Intronic
1098358076 12:69629770-69629792 CTGATAGTTGAGTATAAAAAGGG - Intergenic
1099545679 12:83977017-83977039 CTGAGAAATGATTTAAAACAAGG + Intergenic
1099798207 12:87424292-87424314 ATGATACCTGTATAAAAACATGG - Intergenic
1101259138 12:103011481-103011503 TTGATAAATAAGTAAATACATGG - Intergenic
1104105609 12:125656329-125656351 CTGATAACTGAGCTAATCCAAGG + Exonic
1105610558 13:21965513-21965535 CTGATAACTGTGTAAAATATTGG + Intergenic
1107969104 13:45624168-45624190 CTGACATCTGAGTAAATTCATGG + Intergenic
1108030213 13:46221474-46221496 CTGATAATTCAGCGAAAACATGG + Intronic
1108293591 13:48988667-48988689 CTTATTATTTAGTAAAAACAAGG - Intronic
1108948354 13:56053531-56053553 CTGATAACAGAGAAAAAACAAGG + Intergenic
1109601171 13:64630350-64630372 TTGATAACAGAGAAAGAACACGG - Intergenic
1111157379 13:84345826-84345848 CTGATAACAGAGTAAATGAAAGG + Intergenic
1112072043 13:95863955-95863977 CTGATAAATTAGTAAACACAAGG - Intronic
1113559130 13:111263930-111263952 CTGGGAACAGATTAAAAACAGGG - Intronic
1114130862 14:19790231-19790253 CTGATTACTGAGTGAAAAACGGG - Intronic
1114997092 14:28367414-28367436 ATGATCACTGTGCAAAAACATGG - Intergenic
1115567667 14:34638669-34638691 GTGAGAACAGAGGAAAAACATGG - Intergenic
1115704444 14:35984452-35984474 CTGATGACTGAATAAAAGCTAGG - Intergenic
1116066726 14:39993842-39993864 CTGAAAACTGACATAAAACAAGG - Intergenic
1116098248 14:40400493-40400515 ATGATAACAGAGTAAAAAGTAGG + Intergenic
1116918351 14:50547421-50547443 CTGTGAGCTGAATAAAAACAAGG + Intronic
1117081251 14:52154503-52154525 CAGATAACTGGGTAAGAAGAAGG + Intergenic
1117251166 14:53940165-53940187 CTGAAAACTGAATAACAAGAAGG + Intergenic
1117284456 14:54273355-54273377 CTGATAGTTCACTAAAAACATGG + Intergenic
1117866690 14:60157312-60157334 TTGAGAAATGAGTTAAAACATGG + Intronic
1118169085 14:63368118-63368140 CTGATAAATGAATAAATAGATGG + Intergenic
1118834614 14:69468178-69468200 CTGAACACTGGATAAAAACATGG - Intergenic
1120188144 14:81415869-81415891 CTGAGAACTCAGAAAAAGCAAGG + Intronic
1120249874 14:82050163-82050185 GTGATAAATAAGAAAAAACATGG - Intergenic
1122759212 14:104008997-104009019 CTGAGAAATGAGTAATTACATGG + Intronic
1123306258 15:18428092-18428114 CTGTTAGTTGAGTACAAACATGG - Intergenic
1123359426 15:19311251-19311273 CTGTTAGTTGAGTACAAACATGG - Intergenic
1123372281 15:19523879-19523901 CTGTTAGCTGAGTACACACATGG - Intergenic
1123382090 15:19687958-19687980 CTGTTAGTTGAGTACAAACATGG - Intergenic
1126874347 15:53023593-53023615 AGGAAAAATGAGTAAAAACATGG + Intergenic
1127533279 15:59865669-59865691 GTGAGAACAGAGGAAAAACATGG + Intergenic
1128267635 15:66280486-66280508 CTGATATCTGAGTGCATACACGG + Intergenic
1129975914 15:79821537-79821559 TTGCTAACTGAATAAAAATATGG + Intergenic
1130434359 15:83882668-83882690 CTGATTACTGATTAATAACTTGG + Intronic
1130829861 15:87588316-87588338 CTTATAAATGAGTAAAACCTAGG - Intergenic
1132913504 16:2328526-2328548 CTGAAAACTGAGTGTAAAGAGGG + Exonic
1134211191 16:12278947-12278969 TTGATACCTGATTAAAAAAAGGG + Intronic
1134583017 16:15387749-15387771 CTGATAAGTAAGCAAAAATAAGG + Intergenic
1139960728 16:70715894-70715916 ATGCTTACTGAGGAAAAACAAGG - Intronic
1140151089 16:72366610-72366632 CATATAACTGAGGAAGAACAGGG + Intergenic
1140952752 16:79834891-79834913 GTGATAACAGAGTAGAAAAATGG + Intergenic
1142817501 17:2438287-2438309 TTGTTAACTGATTAAAAAGAAGG - Intronic
1143399142 17:6630166-6630188 ATCAAAACTGAATAAAAACAGGG + Intronic
1146635379 17:34500250-34500272 CTGAGAACTGAAACAAAACAAGG - Intergenic
1147775080 17:42895124-42895146 ATGATAACTGAGTAAAGGAAAGG + Intergenic
1149268184 17:54950844-54950866 GTGAGAGCTGAGGAAAAACATGG - Intronic
1149720684 17:58841094-58841116 CTGATAAGTTAGCAACAACAAGG - Intronic
1151024636 17:70663426-70663448 CTGATAAATGAACAGAAACAGGG + Intergenic
1151029778 17:70723179-70723201 CTAATAAATAAATAAAAACAAGG - Intergenic
1153278619 18:3393254-3393276 CTAAGTACTGAGTATAAACATGG + Intergenic
1153763969 18:8357475-8357497 CTGATCACTAGGTAAAGACACGG - Intronic
1153920717 18:9786686-9786708 GTGAGAACAGAGGAAAAACATGG + Intronic
1155626192 18:27837788-27837810 CTGATAAATGATGAAAAAAAAGG + Intergenic
1156426237 18:37016062-37016084 TTGATAACTGAAACAAAACAAGG - Intronic
1156974448 18:43200716-43200738 CTCACAAATGAGTATAAACAGGG + Intergenic
1159216056 18:65392108-65392130 CTAAAAACTGATTAAAAACTGGG + Intergenic
1161598825 19:5167653-5167675 AAGATAACTGATTAAAATCAAGG + Intronic
1164021859 19:21314692-21314714 CTGGTACTTGGGTAAAAACAAGG - Intronic
1164317234 19:24101947-24101969 CTGGTACTTGGGTAAAAACAAGG + Intronic
1165440822 19:35826329-35826351 CTGGTACCAGAGTAGAAACAAGG - Exonic
1167094824 19:47369572-47369594 CAGATAAATGAGTGAAAACACGG + Intronic
1167318603 19:48781422-48781444 ATTATAACTGAGGAAAAACCAGG - Intergenic
925290756 2:2747051-2747073 CATATAATTGAGTAAATACATGG - Intergenic
926152151 2:10431267-10431289 ATGCTCACTGAGTAAATACAGGG + Intergenic
926877219 2:17494810-17494832 CAGATAACTGAGTATACAGATGG - Intergenic
928666288 2:33553657-33553679 CTGACAACTAAGTAGAAGCAAGG - Intronic
928710822 2:34003378-34003400 CTAATTACTGTCTAAAAACATGG - Intergenic
928798275 2:35052943-35052965 CAGATAAATGATTCAAAACATGG - Intergenic
929260221 2:39858955-39858977 GTGAGAACAGAGGAAAAACATGG - Intergenic
929623078 2:43377296-43377318 CTGATAACTAATTCACAACAAGG + Intronic
930338170 2:50077055-50077077 GTGATAAATGAGCAAACACAGGG - Intronic
931125400 2:59270658-59270680 ATGACAACTAAGTAACAACATGG + Intergenic
933231793 2:79816319-79816341 CTGAGAACTGAAACAAAACAAGG - Intronic
934711187 2:96515241-96515263 GTGCTACCTGAGTAAAATCAAGG - Intergenic
935824388 2:106930102-106930124 CTTATATCTGAGTAAAAACAGGG + Intergenic
936728794 2:115356618-115356640 TTGAAAACTGGTTAAAAACAAGG - Intronic
936919146 2:117669924-117669946 CTGAAAACTGAGGAAATACTAGG + Intergenic
937539846 2:122935718-122935740 CTGAAAATTGAATAAATACAAGG - Intergenic
938089843 2:128424369-128424391 CTGATAACTCAGCACAGACATGG - Intergenic
939476965 2:142699325-142699347 CTGATAACTGAAACAAGACAAGG + Intergenic
939678085 2:145097026-145097048 CTCATGACTGTCTAAAAACAGGG - Intergenic
940733908 2:157427597-157427619 CTGATAACAGAGAAAGAAAATGG + Intronic
941562240 2:167061012-167061034 CTGATAAATGAGAAAATAAATGG - Intronic
941630391 2:167877798-167877820 ATTATAACTCAGTAAAAACAGGG - Intergenic
941688198 2:168469467-168469489 ATGATGACTGAATTAAAACAGGG - Intronic
942667010 2:178330418-178330440 CTGACATCTGAATAAACACATGG - Intronic
942743190 2:179203049-179203071 CTGATAAGTAAGCAACAACAAGG + Intronic
942948156 2:181692071-181692093 CTGATATCTCAGTGAAAATACGG + Intergenic
943222008 2:185121735-185121757 CAGCTAACTGAGTGAAACCAAGG + Intergenic
943379122 2:187120854-187120876 ATGATATCTGAGTAACATCAGGG - Intergenic
943606234 2:189980324-189980346 CTAAAAAATGAGTGAAAACATGG - Intronic
943796745 2:192006033-192006055 CTGAGACCTGAGTAATGACATGG - Intronic
945692343 2:213053610-213053632 CTGAAAACTGAGTTACAAGATGG + Intronic
945833315 2:214810495-214810517 ATTGTAACTGAGTAAAAATAAGG + Intergenic
946598130 2:221328886-221328908 CTGAGAGCTGATTAGAAACAGGG + Intergenic
947537728 2:230951357-230951379 GTGAGAACAGAGGAAAAACATGG + Intronic
948492042 2:238320206-238320228 CTGAGGACTGATTAAGAACAAGG - Intergenic
1169107583 20:3010251-3010273 AGGATAACTGAGTAGAAAGATGG - Intronic
1169777933 20:9276442-9276464 CTGAAAACTCAGTAAAATCCAGG - Intronic
1170779040 20:19407113-19407135 CTGGAAACTGAGTAAGAAGATGG + Intronic
1171440198 20:25154442-25154464 CTGATAAATGGATAAACACAAGG - Intergenic
1173721668 20:45264016-45264038 CTGAGAAAGGAATAAAAACATGG + Intergenic
1173834032 20:46113481-46113503 CTGACTACTCAGTAAAACCAAGG - Intergenic
1174969735 20:55261302-55261324 CTCATAACTGAAAATAAACACGG - Intergenic
1177194899 21:17893640-17893662 CTGATCACTGTATAAAAACAAGG + Intergenic
1177237843 21:18416149-18416171 CAGATAAATGAAAAAAAACATGG + Intronic
1177377130 21:20285730-20285752 GAGGTAACTGAGTTAAAACAAGG + Intergenic
1177494830 21:21874730-21874752 CTGATAACCCAGTAGAAGCAAGG - Intergenic
1177664426 21:24135608-24135630 CTCATTACTGAGTAAATAGAAGG - Intergenic
1178809017 21:35864023-35864045 TTGAAAACTTAGTAAATACAAGG + Intronic
1178912268 21:36684743-36684765 AGGAAAACTGAGCAAAAACAAGG + Intergenic
1179046787 21:37851858-37851880 TTGATATCTGAGGAATAACATGG + Intronic
1179586397 21:42376363-42376385 CAGATCACTGGGTAAACACAGGG + Intronic
1182806063 22:33071615-33071637 CTGTTAACTGTGTGAGAACAGGG - Intergenic
1182907160 22:33948396-33948418 CTGGTTACTTAGTAAAACCAGGG + Intergenic
949222004 3:1646915-1646937 CTGATATATGTGCAAAAACATGG + Intergenic
951153402 3:19320223-19320245 CTGAGAACTGAATCAAGACAGGG - Intronic
951260798 3:20505308-20505330 TTGAGAACTGAGAAAAGACAAGG - Intergenic
951700344 3:25490074-25490096 CTGACAACTGAAAAATAACAGGG - Intronic
952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG + Intergenic
952085812 3:29819634-29819656 CTGATAACTGTGAAAAAATGGGG - Intronic
952699323 3:36309133-36309155 ATGATAAATGAGAAACAACAAGG + Intergenic
952853612 3:37749628-37749650 CTGAGAAATGAGGAAAAAGATGG - Intronic
953258982 3:41319335-41319357 TTGAGAACTCAGTAGAAACAAGG - Intronic
953701056 3:45196174-45196196 ATGATAAAAGAGCAAAAACAAGG - Intergenic
957553932 3:81741589-81741611 CTGATTTCTGTGTACAAACATGG - Intronic
957581064 3:82074051-82074073 CTTTGAATTGAGTAAAAACAAGG + Intergenic
958064234 3:88522401-88522423 CTGAAAACTGAAACAAAACAAGG - Intergenic
958547986 3:95580329-95580351 GTAATAACTGAGTGAATACATGG - Intergenic
959028423 3:101269595-101269617 ATGATAACTATGTAAAAATATGG + Intronic
960160056 3:114340462-114340484 CAGTAAACTGAGGAAAAACAAGG - Intronic
960830030 3:121835906-121835928 TTGATAACTGAGTGAAATCTGGG - Intronic
962472930 3:135729663-135729685 CTGAAAACTGTGTAATTACAAGG - Intergenic
964336184 3:155657025-155657047 CTCATATATGAGTAACAACAAGG + Intronic
965798702 3:172468409-172468431 CTGATAGCTGAACAAAATCAAGG - Intergenic
965994736 3:174867333-174867355 CTGATAACTGATTGACAAGAAGG - Intronic
966359333 3:179118191-179118213 CTGATAACTGCAGAAAATCAAGG + Intergenic
967043374 3:185714847-185714869 CTGAATACTGAGAAAAAGCAAGG - Intronic
968779220 4:2566874-2566896 CTGATTACTATGTAAGAACAAGG + Intronic
970870861 4:20815409-20815431 GTGATATCTGAGTAATAACATGG - Intronic
970879583 4:20913142-20913164 CTGATAAATGAATAAACAAAAGG + Intronic
971351627 4:25861363-25861385 CTGAAATATGAGTAAAAGCACGG + Intronic
971368809 4:25998962-25998984 CTAGTAACAGGGTAAAAACATGG - Intergenic
971466289 4:26965934-26965956 CTGTTATGTGAGAAAAAACAAGG - Intronic
972018325 4:34274897-34274919 CTGATAAATGAATAAAGAAATGG - Intergenic
972765280 4:42147817-42147839 CTGATAAGTGAATAAGAAGAGGG + Intronic
973610315 4:52630165-52630187 ATGATAACGGAGTAGTAACACGG - Intronic
973759374 4:54102178-54102200 CGTATAACAGAGGAAAAACAGGG + Exonic
975167302 4:71191351-71191373 CTGAAAACTAAGTAAATATAAGG + Intronic
976824150 4:89240625-89240647 CTGGTAACTGAGTAGCTACAGGG - Exonic
976972898 4:91129358-91129380 CTGATACCTGAACAAAATCAGGG + Intronic
977786627 4:101042534-101042556 CTGATAATTAAGCAAAACCATGG + Intronic
979134932 4:117099011-117099033 CTGATAATTAAGTAATAATAAGG + Intergenic
982045715 4:151443629-151443651 GGGATAACTGAGGAAAAAGAAGG - Intronic
983410672 4:167393516-167393538 TTGAAAACTGTGTAAAACCAAGG - Intergenic
983588260 4:169379422-169379444 CTGATAACTCAGAAATAAAAAGG + Intergenic
983829571 4:172308391-172308413 CTGAGAACTGGAAAAAAACAAGG - Intronic
986762847 5:10895828-10895850 CTGATGGCTGAGTAACAAAATGG - Intergenic
988320814 5:29693947-29693969 CTTATAAGTTAGTAATAACATGG - Intergenic
988943579 5:36171145-36171167 CTGCTAACTGAGCAAAAACGAGG - Intronic
988977080 5:36526311-36526333 CAGGTAACTGAGGAAAAGCAAGG - Intergenic
989406707 5:41069107-41069129 TTGATAACTGAGAAAAAATTAGG - Intronic
989647587 5:43652089-43652111 CTGGTAACTGAGTTTAAATATGG + Intronic
990742037 5:58922376-58922398 GTGAGAGCTGAGTAAAAGCAAGG + Intergenic
991308412 5:65207749-65207771 ATAATAACTGAGTTCAAACAGGG + Intronic
993301949 5:86222521-86222543 ATGATATCTGAATAAAAATATGG + Intergenic
993306850 5:86284878-86284900 CAGGTAACTGAGAAAAATCAGGG + Intergenic
993400764 5:87447812-87447834 TTGAAAGCTGAGTAATAACAAGG + Intergenic
994324241 5:98430697-98430719 CTGATATTTTAGGAAAAACAAGG - Intergenic
994514632 5:100755037-100755059 GTGACAACTGTGTCAAAACAAGG + Intergenic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
996803688 5:127430847-127430869 CTGATGACAGAGTAAATAAAAGG + Intronic
997441169 5:133909529-133909551 GTGACAGCTGAGTAAAGACATGG + Intergenic
998796461 5:145824853-145824875 TTGATAACTGATGAAAAACTTGG + Intronic
999851831 5:155549097-155549119 TTGAGAACTGGGAAAAAACAAGG - Intergenic
999969922 5:156849082-156849104 GTGGGAACTGAGCAAAAACAAGG + Intergenic
1000744866 5:165020209-165020231 CTGATAAGTAGGCAAAAACAAGG + Intergenic
1001489714 5:172146777-172146799 GTGAGAACAGAGGAAAAACAAGG - Intronic
1004926042 6:20416035-20416057 CTGTTAAATGAGGAAAATCATGG + Intronic
1005760777 6:28965796-28965818 CTGAGAACTGAAACAAAACAAGG + Intergenic
1005939746 6:30552171-30552193 TTGATACCTGAGTAAAAGAATGG - Intronic
1008041039 6:46798314-46798336 CTGATCACTGATTATAAAAAAGG - Intronic
1009380640 6:63024624-63024646 TAGAAAACTGATTAAAAACAGGG + Intergenic
1010064422 6:71664456-71664478 CTGATAACTGAGTCAAATACAGG + Intergenic
1010247529 6:73675552-73675574 ATGATTACTGGGTAAAATCAAGG - Intergenic
1010415448 6:75606419-75606441 CTGTTGACTGAATAAATACAGGG - Intronic
1010736984 6:79454165-79454187 CTGGTAAAGGAGTAAAAACATGG + Intergenic
1011701804 6:89962276-89962298 CTGAAAAGTGAGAAAAAACTTGG - Intronic
1012403173 6:98861983-98862005 TTGAATACTAAGTAAAAACAAGG + Intergenic
1012866844 6:104628022-104628044 CTGGCAACTGAGTAAAAGCATGG - Intergenic
1014155014 6:118100222-118100244 CTGATAAAGGGATAAAAACAAGG - Intronic
1014683784 6:124469159-124469181 CTGATAAATTACTAAAATCATGG - Intronic
1015075426 6:129151073-129151095 CTGATGATAGAGAAAAAACATGG + Intronic
1015654690 6:135504386-135504408 CTGATCAGTGATTAAAAACACGG - Intergenic
1016137306 6:140560315-140560337 TTGATAACTGAAAAAAAAAATGG - Intergenic
1016789025 6:148047500-148047522 CTGATCTCTGAATAGAAACAAGG + Intergenic
1020661189 7:10985318-10985340 CTGAAAACAAAGTAAAAGCAGGG - Intronic
1020924032 7:14301731-14301753 CTAATAAGAGAGTAAAAAAATGG + Intronic
1021287541 7:18799439-18799461 CTGATAACTGAGCTAACTCAGGG - Intronic
1021489066 7:21198591-21198613 TTGATAAGTGAGTTAAAAGATGG - Intergenic
1023676112 7:42631958-42631980 AGGATAAATGAATAAAAACAAGG + Intergenic
1023740337 7:43275031-43275053 CTGATAACTCAGTGACACCATGG - Intronic
1025844614 7:65185108-65185130 CTGATACCTGAGTAAAATCAGGG + Intergenic
1025894943 7:65691446-65691468 CTGATACCTGAGTAAAATCAGGG + Intergenic
1027748729 7:82113342-82113364 CATATAACTTAGTAAAAACAAGG - Intronic
1031127064 7:117786837-117786859 CGGATAACTTATTAAAAATAGGG - Intronic
1031153654 7:118083915-118083937 CTGTTTACTGATGAAAAACACGG + Intergenic
1031240595 7:119233496-119233518 CTCATAACTCAGGAAATACATGG - Intergenic
1031519770 7:122749318-122749340 CTAATAGCTGATTAAAACCAAGG + Intronic
1033623657 7:143086846-143086868 CTGAGAACTGAGACAAGACAAGG + Intergenic
1033990480 7:147278448-147278470 CTGTTGAATGAGTAAAATCATGG + Intronic
1034122150 7:148637741-148637763 GTGAGAACTGAGAAAAGACAGGG - Intergenic
1036545361 8:9763608-9763630 TTTATAACTGCATAAAAACAAGG - Intronic
1037264793 8:17046387-17046409 CTGAGAGCAGAGGAAAAACATGG + Intronic
1037738715 8:21587989-21588011 GTGATAATTGGTTAAAAACATGG + Intergenic
1039105408 8:33984210-33984232 AAGAAAGCTGAGTAAAAACATGG - Intergenic
1039210608 8:35208882-35208904 CTGCTAACTGAATTAAAACAAGG + Intergenic
1040460806 8:47646110-47646132 CTGACAACTCAGTATAAAAATGG + Intronic
1041723158 8:60994276-60994298 GAGATAACTGTGTTAAAACAAGG - Intergenic
1042078050 8:65017484-65017506 CTGATAACTGGATCAAATCAAGG - Intergenic
1043888000 8:85624510-85624532 CTCTTAACTTAGTAAAAACAAGG + Intergenic
1044032434 8:87254818-87254840 CTCAAAACAGAGTAAAAGCAAGG - Intronic
1045162216 8:99560808-99560830 CTGAAAACTGTGTAAAGATAAGG - Intronic
1045342545 8:101267560-101267582 ATGAAAACAGAGTAAACACAGGG + Intergenic
1045408024 8:101886820-101886842 ATGATAATGGAGTAAAAACCTGG - Intronic
1046949669 8:120007897-120007919 CTGGAGACTGAGGAAAAACAGGG - Intronic
1047192574 8:122691465-122691487 CTGAGAACAAAGTCAAAACATGG - Intergenic
1047332165 8:123900542-123900564 CTGAAAACTGGGACAAAACAAGG - Intronic
1050626803 9:7512574-7512596 CTAATAACTAAGGAAAGACAAGG - Intergenic
1050635951 9:7613075-7613097 CTGAGAACTGAAAAAAGACAAGG - Intergenic
1050726806 9:8659335-8659357 CTGAAAACTGATTTAAGACAAGG + Intronic
1051370842 9:16357815-16357837 CTGAGAACTCTGTAAAAATAAGG + Intergenic
1051956314 9:22699305-22699327 CTGACAACTGGGTAAAAGTAAGG - Intergenic
1052039136 9:23718346-23718368 CTGATAATTGTGTCAAATCAGGG - Intronic
1052237844 9:26234373-26234395 CTGATAGCAGAGTAGAAAGAAGG - Intergenic
1052396682 9:27947478-27947500 CTAAGAACTGAGAAAAAACAAGG - Intergenic
1057122996 9:92594070-92594092 CTAATAACAGAGGAATAACAGGG + Intronic
1058318567 9:103600261-103600283 CTGATAATTGAGTAGAAACGAGG - Intergenic
1059521460 9:114946507-114946529 CTAATAAATGAGTGAACACATGG - Intergenic
1059832740 9:118116723-118116745 CTGATAGATGAGTAAAAATCTGG - Intergenic
1059916468 9:119108193-119108215 CTGATAACTGAAAGAAGACAAGG + Intergenic
1186276691 X:7947035-7947057 CTGATAAGTAAGCAACAACAAGG + Intergenic
1187034478 X:15523269-15523291 CTGATAACTGAGTGAGAAGATGG - Intronic
1188436688 X:30168471-30168493 CTTATAACTGAGTAGAAGCAGGG + Intergenic
1188889903 X:35596841-35596863 CTGAGAACTGAAAAAAGACAAGG + Intergenic
1188956436 X:36439632-36439654 CTGCTTCCTGAGTATAAACATGG + Intergenic
1189048092 X:37614548-37614570 ATGAGAACTGCTTAAAAACAAGG + Intronic
1191926143 X:66312168-66312190 CTGATGACAGAGTAAAAAGTAGG + Intergenic
1192604223 X:72497532-72497554 CTGATAAATCAGAAAAGACATGG - Intronic
1193337663 X:80309381-80309403 CTGACTACTGATTAAAAACTGGG + Intergenic
1194951079 X:100126863-100126885 ATCATAAATGAGTAAAAGCAAGG + Intergenic
1194965582 X:100285146-100285168 CTGACAACTCAGTTAAAACGAGG - Intergenic
1194967676 X:100307472-100307494 CTGAGAACTGAAACAAAACAAGG + Intronic
1197452608 X:126638781-126638803 ATGATAACAGAGCAATAACAGGG - Intergenic
1198208006 X:134486931-134486953 CTGACAACTGATTCAAAGCATGG + Intronic
1199272526 X:145900763-145900785 TTAAGAACTGAGAAAAAACAAGG + Intergenic
1201329375 Y:12801310-12801332 ATGTTAACTGGGTAAGAACAAGG + Intronic
1201711637 Y:16999179-16999201 CTGATAACCTAGAAAAAAGAAGG + Intergenic
1201934416 Y:19392110-19392132 CTGAGAACTGAAAAAAAACAAGG - Intergenic