ID: 1064278465

View in Genome Browser
Species Human (GRCh38)
Location 10:13929396-13929418
Sequence CTGCCCGCCTACTACGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064278463_1064278465 -7 Left 1064278463 10:13929380-13929402 CCTGGCAGGTGCAGAGCTGCCCG 0: 1
1: 1
2: 1
3: 37
4: 300
Right 1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG No data
1064278462_1064278465 -4 Left 1064278462 10:13929377-13929399 CCACCTGGCAGGTGCAGAGCTGC 0: 1
1: 0
2: 6
3: 31
4: 320
Right 1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG No data
1064278461_1064278465 5 Left 1064278461 10:13929368-13929390 CCTTTGTGTCCACCTGGCAGGTG 0: 1
1: 0
2: 4
3: 20
4: 193
Right 1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG No data
1064278457_1064278465 14 Left 1064278457 10:13929359-13929381 CCTGGACACCCTTTGTGTCCACC No data
Right 1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG No data
1064278460_1064278465 6 Left 1064278460 10:13929367-13929389 CCCTTTGTGTCCACCTGGCAGGT 0: 1
1: 0
2: 1
3: 11
4: 169
Right 1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064278465 Original CRISPR CTGCCCGCCTACTACGCCCT GGG Intronic
No off target data available for this crispr