ID: 1064278994

View in Genome Browser
Species Human (GRCh38)
Location 10:13933765-13933787
Sequence TCTGTGTCCCAGGGGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064278994_1064279004 24 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA No data
Right 1064279004 10:13933812-13933834 GACTTGGACAGCAGACAAGCTGG No data
1064278994_1064279000 8 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA No data
Right 1064279000 10:13933796-13933818 AAGCAGCTTCCCCAAGGACTTGG No data
1064278994_1064279006 30 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA No data
Right 1064279006 10:13933818-13933840 GACAGCAGACAAGCTGGCTAGGG No data
1064278994_1064278999 2 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA No data
Right 1064278999 10:13933790-13933812 GAAAGGAAGCAGCTTCCCCAAGG No data
1064278994_1064279005 29 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA No data
Right 1064279005 10:13933817-13933839 GGACAGCAGACAAGCTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064278994 Original CRISPR TCTGTGTCCCAGGGGCCTCT AGG (reversed) Intronic