ID: 1064278994

View in Genome Browser
Species Human (GRCh38)
Location 10:13933765-13933787
Sequence TCTGTGTCCCAGGGGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064278994_1064279004 24 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA 0: 1
1: 0
2: 4
3: 26
4: 291
Right 1064279004 10:13933812-13933834 GACTTGGACAGCAGACAAGCTGG No data
1064278994_1064279000 8 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA 0: 1
1: 0
2: 4
3: 26
4: 291
Right 1064279000 10:13933796-13933818 AAGCAGCTTCCCCAAGGACTTGG No data
1064278994_1064279005 29 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA 0: 1
1: 0
2: 4
3: 26
4: 291
Right 1064279005 10:13933817-13933839 GGACAGCAGACAAGCTGGCTAGG No data
1064278994_1064279006 30 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA 0: 1
1: 0
2: 4
3: 26
4: 291
Right 1064279006 10:13933818-13933840 GACAGCAGACAAGCTGGCTAGGG No data
1064278994_1064278999 2 Left 1064278994 10:13933765-13933787 CCTAGAGGCCCCTGGGACACAGA 0: 1
1: 0
2: 4
3: 26
4: 291
Right 1064278999 10:13933790-13933812 GAAAGGAAGCAGCTTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064278994 Original CRISPR TCTGTGTCCCAGGGGCCTCT AGG (reversed) Intronic
900098195 1:948913-948935 TCTGTGTGGCAGGGACCTCTAGG - Intronic
900103698 1:973418-973440 TCTCTGTGCAAGAGGCCTCTGGG - Intronic
900180990 1:1310880-1310902 TCTGGGTCACAGGTGGCTCTGGG + Intronic
900463283 1:2811408-2811430 TCCTTGTCACAGGGGCCTCCAGG + Intergenic
900494357 1:2969718-2969740 GGGGTGTCCCAGGGGCCTCCTGG + Intergenic
901240568 1:7690735-7690757 TCTGTGGAACAGGGGCCTCACGG - Intronic
902184888 1:14717715-14717737 TGTCAGCCCCAGGGGCCTCTTGG - Intronic
902399456 1:16150175-16150197 GCTGTCTCCCAGGGGCTACTTGG - Intronic
903328341 1:22584167-22584189 TCTGAGCCCCGGGGGCCGCTGGG - Intronic
904044164 1:27600293-27600315 TCTGGGTCCCCTGGGTCTCTTGG - Intronic
905309998 1:37042608-37042630 TCTGTCTCCCAGGGGCCAGAAGG + Intergenic
905647265 1:39633231-39633253 TCTGGGTCACAGGCCCCTCTCGG + Intronic
905684127 1:39896685-39896707 TCTTTGTCTCAGAGCCCTCTGGG - Exonic
905733609 1:40312102-40312124 TCTGCTCCCCAGGGGCCTCCTGG - Exonic
907457004 1:54582377-54582399 CCTGTGTGCCAGGCCCCTCTAGG + Intronic
907927688 1:58970004-58970026 TCTGGGCCCAAGGGTCCTCTGGG - Intergenic
907998282 1:59654977-59654999 TCTGTGTCCCTGGGCACTCAGGG + Intronic
908417577 1:63928354-63928376 TCTGAGTGCCAATGGCCTCTTGG - Intronic
913089867 1:115469351-115469373 CCTGGGACCCTGGGGCCTCTTGG + Intergenic
913259799 1:116987831-116987853 ACTGTGTCTCAGGGGACTCCAGG + Exonic
914886164 1:151586125-151586147 TCTGTGTCTCAGGGGGCTCCAGG - Intergenic
922290555 1:224205770-224205792 GCTGTGTCCCAGGGCCTGCTTGG + Intergenic
922801835 1:228368045-228368067 TCTCTAGCTCAGGGGCCTCTGGG + Intronic
923762041 1:236855659-236855681 TCTGCCTCACAGGGGCCTCACGG - Intronic
1064278994 10:13933765-13933787 TCTGTGTCCCAGGGGCCTCTAGG - Intronic
1065319185 10:24493252-24493274 TCTCAGTCCCACAGGCCTCTGGG - Intronic
1065887400 10:30090730-30090752 GCTGTGTCCCAGAGGCCTGGAGG - Intronic
1066056557 10:31686478-31686500 TCTGTGTCCCAGCAGCAGCTTGG - Intergenic
1066563118 10:36691769-36691791 TCAGGGACTCAGGGGCCTCTGGG + Intergenic
1067029954 10:42873261-42873283 CCTGTGTCCCAGAGGCGACTAGG + Intergenic
1067909897 10:50335607-50335629 TCTGTGTCCCACCAGCCTGTCGG - Intronic
1067986603 10:51154275-51154297 TCTGTCTCCCAGGGGACATTTGG + Intronic
1069510961 10:69042302-69042324 ACTGTCTGCCAAGGGCCTCTTGG + Intergenic
1069570792 10:69493171-69493193 TTTGTGACCTGGGGGCCTCTGGG + Intronic
1070836026 10:79447157-79447179 TCTGAGATCCAAGGGCCTCTTGG - Intergenic
1070963630 10:80516323-80516345 GGTGTGTCCCAGGAGCCTATAGG + Exonic
1071109513 10:82138716-82138738 TCTGTGGCCCAAGAGCCCCTGGG + Intronic
1072546955 10:96447365-96447387 CCTGTGTCCCAGGGCAATCTTGG - Intronic
1072690709 10:97570804-97570826 TCTGGGCTCCAGGGGCCTCCTGG - Exonic
1074275743 10:112000214-112000236 CCTCTGCCCCAGGGTCCTCTTGG - Intergenic
1074781654 10:116806712-116806734 TCTGTCTCCCAATGGCCTCTCGG - Intergenic
1075342177 10:121655848-121655870 TCTGTGGCTCTGGGGCCACTGGG + Intergenic
1076885286 10:133259257-133259279 GCTGTGCCCAAGGGGCCTCGGGG + Intergenic
1076982611 11:212883-212905 TCTGGCTGCCAGGGGCCTCATGG + Exonic
1077116836 11:889020-889042 TCTGTGCCCCAGGGCCCTGGGGG + Intronic
1078642942 11:13113386-13113408 TCTGTGACCCATGGGTCACTGGG + Intergenic
1084513018 11:69617842-69617864 ACTGTGTGCCAGGGGGCTCGGGG - Intergenic
1084545320 11:69812459-69812481 ACTGTGGCCCAGGGGGCACTGGG - Intronic
1084601532 11:70148757-70148779 TGTCTGTCCCAGGCACCTCTGGG + Intronic
1084920596 11:72466434-72466456 TCTGTGTCTTAGGGTTCTCTTGG - Intergenic
1085260714 11:75203201-75203223 TCTGGGTTACTGGGGCCTCTTGG - Intronic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1087066223 11:94030451-94030473 TCTGGGTCCCAGGTTCCTTTTGG + Intronic
1087891753 11:103544089-103544111 TCTGTGTACCAGGCCTCTCTGGG + Intergenic
1088215353 11:107501928-107501950 TCTGTTTACCTGGGGACTCTGGG + Intergenic
1088818959 11:113440860-113440882 TCTGTGTCCCAGGAGCCCCAAGG - Intronic
1089684560 11:120138457-120138479 CTTCTGCCCCAGGGGCCTCTGGG - Intronic
1090026519 11:123172184-123172206 TCTGTTGCCCAGGTGCCTCCTGG + Intronic
1093066076 12:14659677-14659699 TCTGTACCCCAGGAGACTCTTGG + Intronic
1094393439 12:29978426-29978448 TATGAGTTCCAGGGGCCTCACGG + Intergenic
1094846804 12:34364902-34364924 TGTGTGGCCCAGGGGACCCTTGG - Intergenic
1095984903 12:47992921-47992943 TGTGTGTTCCAGGGTCCTCGTGG - Exonic
1096611587 12:52805559-52805581 CCTGTGTCCATGGGGCCTCATGG - Intergenic
1096676588 12:53229662-53229684 GCTGTGGCCCAGGGGCCTCAGGG - Intronic
1097070273 12:56349499-56349521 TGGCTGTCCCAGGGGCCACTAGG - Exonic
1098944483 12:76574395-76574417 TCAGTGTTCCACAGGCCTCTAGG + Intergenic
1102171929 12:110848842-110848864 TCTATGTTCCAGGGCCCTTTGGG - Intronic
1103726442 12:122999619-122999641 GCTGTGTTCCAGGGGCCTCTGGG - Intronic
1104584247 12:130035140-130035162 TCTGTGGACCAGGAGCCCCTGGG + Intergenic
1104828845 12:131734145-131734167 TCTCTGTGCCAGGGGCCACCTGG - Intronic
1105584028 13:21727135-21727157 TGTGTGTCACAGGGAGCTCTGGG + Intergenic
1106023729 13:25938623-25938645 TGGGTCTCCCAGGAGCCTCTAGG + Intronic
1106049788 13:26179457-26179479 TCTGTATCCCAGGGGCATTTGGG + Intronic
1108681392 13:52783579-52783601 TCAGTCTCCCTGGGCCCTCTTGG - Intergenic
1113457931 13:110462203-110462225 TCAGTGCCCCAGGGGCCGCGTGG - Intronic
1113525929 13:110976388-110976410 TGTGTGTCTCAGGGTCCTGTAGG - Intergenic
1113636463 13:111922268-111922290 TCTGTGTCCCTGGGGGAGCTGGG - Intergenic
1113719812 13:112546691-112546713 TCTGTGTCCAGCGGGCCCCTGGG - Intronic
1113765996 13:112881516-112881538 CCTGTATCCCTGGGGCCCCTGGG + Intronic
1113905721 13:113818306-113818328 GCTGTGTTCCACGGGCTTCTTGG + Intergenic
1117309861 14:54510269-54510291 TCCGTGTCGCTGGGGCATCTTGG + Intronic
1117839674 14:59846574-59846596 TGTGTATCCCAAGGGCCTTTGGG + Intronic
1118821613 14:69349592-69349614 TCTGAGGCACAGGAGCCTCTCGG - Intronic
1120050694 14:79862179-79862201 TCTGTCTCCCAGCGACCGCTGGG - Exonic
1121662665 14:95647028-95647050 CCTGTCTCCCAGAGGCCTCCTGG - Intergenic
1122046498 14:99027687-99027709 ACTGTCTCCCAGGAGCCTCAAGG + Intergenic
1122715146 14:103692246-103692268 TCTGTGACACTGGGGGCTCTAGG - Intergenic
1123048504 14:105529812-105529834 TCTGCGCCCCAGGGGCGTGTCGG - Exonic
1127004795 15:54556515-54556537 TCTGTGATCCAGGTGCCTCCAGG - Intronic
1127362567 15:58257711-58257733 TTTGTGTCCCAGGAGTCTCTTGG - Intronic
1128081086 15:64857243-64857265 CCTATGTCCCTGGGGCTTCTTGG + Intronic
1128127186 15:65201840-65201862 TCTGGGTCCCTGGGGCCCCTGGG - Intronic
1128612001 15:69081541-69081563 TCTGTGTGGCTGGGCCCTCTGGG + Intergenic
1129673862 15:77621957-77621979 GCTGGGGCCCAGGGTCCTCTGGG + Intronic
1129873503 15:78956895-78956917 TCTATGTGCCAGGGTCATCTGGG + Intergenic
1130106301 15:80931149-80931171 TCTGGGTCTCAGGGCCTTCTTGG + Intronic
1131797594 15:96035257-96035279 CCTGTTTCCCAGGTGCCTCATGG + Intergenic
1131806096 15:96124492-96124514 TCAGAGTCACAGGGGACTCTGGG + Intergenic
1131826098 15:96323322-96323344 TCTGTGTCCCCTGGCCCTCCTGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132923315 16:2411760-2411782 TCTGTCTCCTAAGGGACTCTTGG + Intergenic
1133428081 16:5710757-5710779 TCTGTGTCCCTGGGGACCCCTGG + Intergenic
1135226342 16:20662217-20662239 TGTGTGTCCCAGGGGCTTGATGG + Intronic
1135495971 16:22951396-22951418 TCTCTGTTGCAGGGGCCCCTTGG - Intergenic
1135734658 16:24921062-24921084 TCTGAGACCCACTGGCCTCTGGG - Intronic
1138679824 16:58676503-58676525 CTTATGTCCCAGGGCCCTCTGGG + Intronic
1139274754 16:65717042-65717064 GGTGTGTCCCAGGGACCTATTGG - Intergenic
1139642432 16:68302204-68302226 AGTGTTTCCCAGGGGCCTCCTGG - Intronic
1142606777 17:1086249-1086271 TGTGTGCCCCAGGGGACTCAAGG + Intronic
1143097392 17:4485770-4485792 TCTCTGCCCCAGGGGCCTTGAGG + Intronic
1143509653 17:7388495-7388517 GCTGTGCCCCAGGGACCTCCAGG + Exonic
1144253642 17:13444106-13444128 GCTGTTTGCCAGGGCCCTCTGGG + Intergenic
1144666207 17:17103987-17104009 TGTGTGTCCCTGGTGGCTCTGGG + Intronic
1145272525 17:21412488-21412510 TGTGTGGCCCAGGGGCCTTGAGG - Intronic
1145310735 17:21699951-21699973 TGTGTGGCCCAGGGGCCTTGAGG - Intronic
1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG + Intronic
1146054873 17:29576016-29576038 TCTGAGCCCCAGGGGGTTCTGGG - Intronic
1146462249 17:33055386-33055408 TCTGGTTACCAAGGGCCTCTGGG + Intronic
1147189803 17:38731757-38731779 TCTGTGGCCCAGGCGCTTCCTGG - Intronic
1147586666 17:41657038-41657060 TCTGGGTCCCTGTGGCATCTGGG + Intergenic
1148206354 17:45782806-45782828 TCAGTGTCCCAGGCCCCTTTAGG + Intergenic
1148865044 17:50624025-50624047 CCTGTGTCCCAGGGGCCCCTCGG - Exonic
1150328160 17:64273396-64273418 TGTGTGTCACAGGGCCCTTTTGG - Intergenic
1150329297 17:64282295-64282317 TGGGTATCCCAGGGGCCTCATGG + Intergenic
1151218585 17:72594167-72594189 TCTGTGCTTCAGGGGCATCTAGG - Intergenic
1152293463 17:79453749-79453771 TCTCTCCCCCAGGGTCCTCTGGG - Intronic
1152537618 17:80959804-80959826 GCTGGGTCCCAGGCGCCTCAGGG + Intronic
1152570823 17:81120571-81120593 TCTGAGTTCCAGGGGCCCCCAGG - Exonic
1152601866 17:81266694-81266716 TCTGTTTCCCAGGTGGCTGTTGG - Intronic
1152718336 17:81910602-81910624 TCTGTGTCCGAGTCACCTCTGGG - Intronic
1152848263 17:82615836-82615858 CCAGTGCCCCAGGGGCCTCCTGG - Exonic
1153291769 18:3508831-3508853 TCTGTGTCACAGAGGCTCCTGGG + Intronic
1154491337 18:14924641-14924663 TCTGTAGCCCAGGGCCCTCATGG - Intergenic
1155219539 18:23671791-23671813 TCAGTGTCCCAGGGGGATCTGGG + Intergenic
1156269129 18:35515054-35515076 TCTGTGCCCCAGGTACCCCTAGG + Intergenic
1156293567 18:35770822-35770844 TATGTGTCCCAGTGTCCTCTGGG - Intergenic
1156553922 18:38046215-38046237 TCTGTGCCCCAGTGCCCTCAAGG - Intergenic
1157555317 18:48609762-48609784 TCCCTGTCCCTGGTGCCTCTAGG + Intronic
1158412731 18:57222094-57222116 TCTGTGTCCCCAGGCCCCCTAGG + Intergenic
1159972581 18:74671954-74671976 TCTGTCACCCATGGGCATCTAGG + Intronic
1160059199 18:75514317-75514339 TCTGTGTCCCAGGAACATCCCGG - Intergenic
1160776536 19:859206-859228 TCTCTGTCCCTGTGGCCTCTGGG - Intergenic
1161006086 19:1937471-1937493 CCTGTGGCCCGGGGCCCTCTCGG - Intergenic
1161137288 19:2627185-2627207 TTTCTGTCCCAGGGGACGCTGGG + Intronic
1161745684 19:6058288-6058310 TCTGCGCCCCAGGGGACACTGGG - Intronic
1161894507 19:7069965-7069987 TCTGCGCCCCAGGGGACTTTTGG + Intronic
1162151153 19:8646598-8646620 TCTTTAACCCAGGGGCCTCGGGG - Intergenic
1162650878 19:12088058-12088080 TCTGTAACCCTGGGGCTTCTTGG - Intergenic
1165160552 19:33813229-33813251 TCTGAGGCCCCGGGGCCTGTTGG + Exonic
1165943640 19:39428456-39428478 GCTGTGTCCCGGGGGCCCCGTGG + Intergenic
1166226563 19:41399380-41399402 TCTCAGTCCCAGGGGCCCATTGG + Intronic
1166808333 19:45499980-45500002 TCTGCTTCCCTGGGGCCCCTAGG + Exonic
1167646057 19:50705677-50705699 TCTGTCTCCCAGGGGACACTTGG - Intronic
1168009755 19:53520897-53520919 GCCGTGACCCAGAGGCCTCTGGG - Intergenic
1168009773 19:53521011-53521033 ACTGTGCCCCAAGGCCCTCTGGG - Exonic
1168594524 19:57664527-57664549 TCACTGTCCCAGGGGCCCCTCGG - Intergenic
1168646605 19:58063128-58063150 TCTGTGTCCCAGGGTTGTCCTGG + Intronic
1202714670 1_KI270714v1_random:35706-35728 AATGTGTCTCAGGGGCTTCTAGG + Intergenic
925160728 2:1681614-1681636 TCTGTGTTCCTGTCGCCTCTGGG - Intronic
925832219 2:7907151-7907173 TTTGTCTCCCAGGGAACTCTGGG - Intergenic
925923434 2:8653615-8653637 GCTGTGCACCAGAGGCCTCTAGG + Intergenic
926148823 2:10413223-10413245 GCTGTGTCCCAGGAGCCCCAGGG - Intronic
926591231 2:14742348-14742370 TCTTTGTCCCAGGGACAGCTAGG - Intergenic
927464068 2:23324010-23324032 TCTGGGTCCCAGTGCCCTGTGGG - Intergenic
927495893 2:23551642-23551664 TCTGTCCCCCAGGGCCATCTAGG + Intronic
928092989 2:28387376-28387398 TCAGTCTCCTAGGGGCCTCGTGG + Intergenic
928633999 2:33224036-33224058 TCTCTGTCCCAGGGGACTGATGG + Intronic
929778008 2:44940511-44940533 TCTGTGTTCTATGGGCCTTTTGG + Intergenic
929960729 2:46494364-46494386 TCTGTCTCCAAAAGGCCTCTTGG + Intronic
930032952 2:47069482-47069504 TTTGAGGCCCAGGGGGCTCTGGG + Intronic
930718142 2:54612578-54612600 TCAGCGGCCCAGGGGCTTCTAGG + Intronic
931791179 2:65665718-65665740 GCTGTGTCCCAGTGGCCCCCAGG + Intergenic
932296397 2:70626793-70626815 GCTGTGACCCAGGGGCCTTTGGG + Intronic
932421746 2:71605453-71605475 TCTGTATCCTAGGGGGCCCTGGG - Intronic
932822341 2:74912151-74912173 TCTGAGCCCAAGTGGCCTCTTGG + Intergenic
935060336 2:99601630-99601652 TCTGCTTCCCGGGGGCCTCGCGG - Intronic
937239683 2:120452092-120452114 TCTGTCCCCCAGTGGCCTCCTGG + Intergenic
937341126 2:121091262-121091284 TCTGTTTCCCAGGGGTCACTGGG - Intergenic
937434172 2:121866682-121866704 TCTGCTTCCCAGCAGCCTCTTGG - Intergenic
938256684 2:129864784-129864806 TCTGTGGCACATAGGCCTCTGGG - Intergenic
939323745 2:140659503-140659525 CCTGAGTACCAGGGGCATCTTGG - Intronic
939861840 2:147429969-147429991 TCTCTGTCCCAGGGACCTTGTGG - Intergenic
942367622 2:175244331-175244353 TCTGTGCCCCAGGGGCCCAAAGG + Intergenic
947084871 2:226439487-226439509 TTTGTATCCCACGGGCATCTGGG + Intergenic
947301258 2:228690323-228690345 TCTGTCTCCTAGGGGACACTGGG - Intergenic
948530130 2:238598857-238598879 TCTGTGCCTCAGGGATCTCTGGG + Intergenic
948728185 2:239947321-239947343 GCTCTGTCCCTGGGGGCTCTGGG - Intronic
948832398 2:240604463-240604485 TGTGTCACCCAGGGGCCTCTAGG + Intronic
1168790808 20:574598-574620 CCTGGGTCCCAGGGGCCTGCTGG + Intergenic
1168843219 20:923089-923111 TCTCGGTCACAGGGTCCTCTGGG - Intergenic
1170403686 20:16013853-16013875 TCTATGTGCCAGGTGCCTTTAGG + Intronic
1170776843 20:19382495-19382517 TCTTTGTTCCAGGGGCCTTGCGG + Intronic
1172620349 20:36314243-36314265 TCTGGTTCACAGGGGACTCTGGG + Intronic
1173165094 20:40682561-40682583 TATGGGTCCAAGAGGCCTCTGGG + Intergenic
1173404624 20:42753790-42753812 CCTCTGTCCCAGTAGCCTCTTGG + Intronic
1173472225 20:43332870-43332892 ACTGTGTCCCACTGGTCTCTTGG + Intergenic
1173841124 20:46157944-46157966 GCTGTCTCCCAGGGGCCGCTGGG - Intergenic
1173947645 20:46964416-46964438 TCTGTGTGCCAGGTGCTACTTGG - Intronic
1174036158 20:47669506-47669528 TCTGTCCCCCAGGGGACACTTGG - Intronic
1174113038 20:48209256-48209278 ATCGTGTCCCAGGGGCTTCTAGG - Intergenic
1174390516 20:50216064-50216086 TCTGTTTCCCAGGAGGCTCCTGG + Intergenic
1174525395 20:51166354-51166376 ATTGTGTCCCAGGGGCTTCCAGG + Intergenic
1175873412 20:62218863-62218885 TCTGTGTCCCCTGGGCCTGGGGG + Intronic
1176099644 20:63359104-63359126 TCTGTGGGTGAGGGGCCTCTGGG + Intronic
1176411483 21:6451614-6451636 TTACTGTCCGAGGGGCCTCTGGG + Intergenic
1177941543 21:27417741-27417763 TCTGTTGCCCAGGGGGCTCTGGG - Intergenic
1178443524 21:32618080-32618102 TCTGTGGCCTGGGGGCCTCAAGG - Intergenic
1179686976 21:43059936-43059958 TTACTGTCCGAGGGGCCTCTGGG + Intronic
1179878267 21:44282394-44282416 TCTGCTGCCCAGGTGCCTCTTGG + Intergenic
1180002849 21:45002891-45002913 TATGGGTCCCGGGGGCATCTGGG - Intergenic
1180081378 21:45489336-45489358 TCAGTGTCCCTGGGACCCCTCGG + Intronic
1180801068 22:18632217-18632239 GCTGTGTCCCCGGGTCCACTGGG - Intergenic
1181220651 22:21363044-21363066 GCTGTGTCCCCGGGTCCACTGGG + Intergenic
1182709585 22:32312179-32312201 TCTGTGTCTCAGGGAGCACTGGG - Intergenic
1184241681 22:43214356-43214378 TCTGTGTCCTTGGGGCCCCAGGG - Intronic
1184289203 22:43489327-43489349 TGTGTGGCTCAGAGGCCTCTAGG + Intronic
1185176151 22:49328169-49328191 TGTGTGTCCCTGGGGCTCCTTGG - Intergenic
1185235905 22:49712782-49712804 TCTTTGTGTCAGAGGCCTCTGGG - Intergenic
950484732 3:13266458-13266480 TCTGGGCCTCAGGGGCCTGTGGG - Intergenic
950739691 3:15040472-15040494 TCTGTGTTCCATGGGGCTCCTGG - Intronic
950956528 3:17059150-17059172 TGTATGTCCCAGGGCCCTCCTGG - Intronic
951627659 3:24683691-24683713 TATGAGTCCCAGGGGCCTCCAGG - Intergenic
955752533 3:62197092-62197114 TCTGAGTCCCAGCTGCCTTTTGG + Intronic
956751833 3:72349621-72349643 TCTGTGTTCCTAGGGCATCTTGG - Intergenic
959117501 3:102195400-102195422 TCTGTGTCCCAGGGGTCAAGTGG - Intronic
960702272 3:120450636-120450658 ACTCGGTCCCCGGGGCCTCTTGG - Intronic
961675210 3:128560841-128560863 TCTCTGTCCTGGGGGGCTCTGGG - Intergenic
964324911 3:155535151-155535173 ACTGTCTCACAGGGGCCTTTGGG + Intronic
967303446 3:188038835-188038857 TCTGTTTCCCAGGGAACCCTAGG - Intergenic
967329495 3:188276436-188276458 TTCGTGGCCCTGGGGCCTCTGGG + Intronic
968655439 4:1776591-1776613 CCCCTGTCCCAGGGGCCACTCGG + Intergenic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
977804620 4:101282238-101282260 TCTTGGTTGCAGGGGCCTCTAGG - Intronic
982042578 4:151409796-151409818 CCTTGGTCCCAGGGTCCTCTGGG + Intronic
984472216 4:180190728-180190750 TTTGTTTACCAGGGTCCTCTTGG + Intergenic
985873727 5:2579109-2579131 CCTCTCTCCCAGGGGACTCTCGG + Intergenic
986307241 5:6524898-6524920 AGTGTCTCCCAGGGGCCCCTGGG - Intergenic
989220166 5:38949976-38949998 TCGGTGTCCCTGGTGCCTCCAGG - Exonic
990224250 5:53631504-53631526 GCTCTGTCCCAGGGGAATCTGGG + Intronic
992039719 5:72817282-72817304 TCTTTCTCCTTGGGGCCTCTTGG + Intronic
993135009 5:83949865-83949887 TTTGTTTCCCAGGGGGCTCTGGG + Intronic
996932335 5:128904787-128904809 TGTGTGTCACTGGGGCCTGTCGG - Intronic
997262415 5:132475165-132475187 TCTCTGGCTCTGGGGCCTCTGGG + Intronic
997530196 5:134577197-134577219 GGGCTGTCCCAGGGGCCTCTGGG - Intronic
999230456 5:150058818-150058840 TCTCTGTCTCAGGGGCTTGTGGG - Intronic
1001001479 5:168011612-168011634 TCTGTGTCCCTCGTTCCTCTTGG + Intronic
1001281530 5:170389530-170389552 TCTGTTTCCCACGAGACTCTGGG - Exonic
1001314291 5:170631755-170631777 CTTCTCTCCCAGGGGCCTCTGGG + Intronic
1002428746 5:179191147-179191169 AGTGTCCCCCAGGGGCCTCTCGG + Intronic
1003004718 6:2370036-2370058 CCTGCATCCCAGGGGCCTCAGGG + Intergenic
1003494861 6:6654831-6654853 TCTGTTTCTAAGGAGCCTCTTGG + Exonic
1003501228 6:6704547-6704569 ACTATCTCCCAGAGGCCTCTGGG + Intergenic
1005722438 6:28616420-28616442 TCTGTGTCCCGGCGGCCACCCGG + Intergenic
1007688648 6:43683136-43683158 TCTGTTTTCCAGGGGCCAGTGGG - Intronic
1007925126 6:45644133-45644155 CGTGTCTCCCAGGGGCCTCTGGG - Intronic
1008228000 6:48945774-48945796 TATGTGTCCCAGGGGCTTAGAGG - Intergenic
1008463545 6:51804292-51804314 GCTGTGTCCCAAGTCCCTCTAGG + Intronic
1015093233 6:129384624-129384646 TCTGGGTGCCTAGGGCCTCTAGG + Intronic
1015803945 6:137089942-137089964 CCTGTGTACCAGGTGACTCTAGG + Intergenic
1017103083 6:150865681-150865703 TCCTCGTCCCAGGGGCCCCTAGG - Exonic
1018333531 6:162760152-162760174 TATGACTCCCAGGTGCCTCTAGG + Intronic
1018729259 6:166636652-166636674 TCTGTGTCACAGCAGCCTCTGGG - Intronic
1018918129 6:168150708-168150730 TCTGTGGCTCCGGGGACTCTAGG - Intergenic
1019062607 6:169266863-169266885 TGTGTGTCCCAGGGCCCCCAGGG + Intergenic
1019311471 7:363671-363693 GGTGTGTCCCAGGGGCCTGCTGG - Intergenic
1019314682 7:379033-379055 CCTGGGTCGCAGGGGTCTCTGGG + Intergenic
1019324484 7:431599-431621 CCTGGGTCCTGGGGGCCTCTGGG + Intergenic
1019815593 7:3197521-3197543 GCTGTCTCCCAGGCTCCTCTTGG - Intergenic
1020131239 7:5559719-5559741 TCTGTGTCCCCTGGGCTGCTTGG - Intronic
1023091216 7:36619192-36619214 ACTGTGTCCCAGGGACCCCAGGG - Intronic
1025766839 7:64463938-64463960 TCTGTGTCCCTGTGACCTGTAGG + Intergenic
1025777832 7:64574771-64574793 TCTGTGTCCCTGTGACCTGTAGG + Intergenic
1027631035 7:80606671-80606693 TCTGGGTCCGAGGGTCATCTTGG + Intronic
1027855793 7:83509348-83509370 TCTGTGTGCCAGGGCCCTTCAGG - Intronic
1028728915 7:94122314-94122336 TATTTGTCCCAGTTGCCTCTTGG + Intergenic
1029521625 7:101066471-101066493 TCTGCATCCCAGGGGGCCCTTGG + Intergenic
1029587600 7:101485461-101485483 CGTGTGTCCCAGGGGAGTCTTGG - Intronic
1029869962 7:103680333-103680355 TCTGAGTCCCCAGGGGCTCTGGG + Intronic
1031985915 7:128164639-128164661 TGTGAGTCCCAGGGGCCTGCCGG - Intergenic
1034486894 7:151371413-151371435 TCTGTGTCCCAGAATCCTCAGGG + Intronic
1035345319 7:158193455-158193477 TCTGTCTCTCCGGGGCCTGTTGG - Intronic
1035353805 7:158265272-158265294 TGTCTGTGTCAGGGGCCTCTGGG - Intronic
1035396369 7:158537640-158537662 TCTGTGTCCCACAGGTCTGTGGG - Intronic
1036601554 8:10265343-10265365 GGTGTGTCACAGGGGCTTCTGGG + Intronic
1036910540 8:12754582-12754604 TCTGCTTCCCCGGGGCCGCTGGG - Intronic
1038257773 8:25966393-25966415 TCTGAGTCCCAGGAGCTTCTAGG - Intronic
1039659346 8:39446423-39446445 CCTCTGTCCCAGGAGCATCTTGG + Intergenic
1042507642 8:69577956-69577978 TCTGTTTGCCAGGGTCCTCATGG - Intronic
1049462980 8:142738706-142738728 TCTGTGTCCCTGGGCCCTGAGGG - Intergenic
1049497353 8:142942523-142942545 ACTGTGTCCCAGGAGCCTGCTGG + Intergenic
1049593838 8:143474486-143474508 TCTGGGCTCCAGGGGCTTCTGGG - Intronic
1049853461 8:144847142-144847164 CCTGTGTGCCAGGGGCCACCTGG - Intronic
1054812783 9:69447890-69447912 ACTGTGTCCACGGGGCCCCTGGG + Intronic
1055348984 9:75365622-75365644 GCTCTGTCCCAGGGTGCTCTGGG + Intergenic
1057172174 9:92969556-92969578 CCTGTGTGCCGGGGGCCACTGGG + Intronic
1057714972 9:97485874-97485896 TCTGTGTCCCAGTTGTCTCTGGG + Intronic
1058447244 9:105064844-105064866 TCTGAGAGCCAGGGGCCTTTAGG - Intergenic
1059335952 9:113568596-113568618 CCTGTTCCCCAGGCGCCTCTGGG + Intronic
1059434194 9:114266553-114266575 TCTGTCTTCCAGGGCCCTCAGGG + Exonic
1060983125 9:127804727-127804749 TCTGTGTCCCAATGGACCCTGGG + Intronic
1061452997 9:130678652-130678674 TCTGTGTCTCAGCGGCCCCATGG - Intronic
1062067694 9:134537530-134537552 ACTGAGACCCAGGGGCCTTTTGG - Intergenic
1062279489 9:135745601-135745623 TCTGTGTCCCAGGCTTCTCTTGG - Intronic
1062451039 9:136615966-136615988 GCTTTGTTCCAGGGGCCCCTGGG - Intergenic
1062480115 9:136747218-136747240 TCTGTGTCCCTGGGGCCTCCAGG - Intronic
1062611268 9:137374746-137374768 TCTCTGTCCCTCGGGACTCTGGG + Intronic
1203745653 Un_GL000218v1:39553-39575 TCTCTGTCCCCGTGGCCTCCAGG + Intergenic
1188649948 X:32620048-32620070 TCTGTTACCCAGGTTCCTCTTGG - Intronic
1189645103 X:43119824-43119846 TTTGGGTCCCAGTGGCCTCCAGG + Intergenic
1190687711 X:52889203-52889225 TCTATGTCACTGGGGTCTCTTGG + Intergenic
1190698271 X:52966589-52966611 TCTATGTCACTGGGGTCTCTTGG - Intronic
1193169194 X:78316229-78316251 TGTATGTCACAGGGGCCTTTGGG + Intronic
1196157845 X:112450489-112450511 GCTTTGTCCCAGGATCCTCTGGG + Intergenic
1198125040 X:133635330-133635352 GCTGTGTCCCAGAGACCTCCAGG - Intronic
1198215365 X:134549960-134549982 TGTCCGTCCCAGGAGCCTCTGGG - Intergenic
1199582672 X:149376066-149376088 TCTGATGCCCAGGGGCCTCTTGG + Intergenic
1199982568 X:152928987-152929009 GCTGTGTGCCAGGAGCCCCTGGG + Intronic
1202118480 Y:21499236-21499258 TATGTGTCCCATGTGCATCTTGG + Intergenic
1202120932 Y:21522776-21522798 TATGTGTCCCATGTGCATCTTGG + Intronic
1202123383 Y:21546317-21546339 TATGTGTCCCATGTGCATCTTGG + Intronic
1202155625 Y:21883064-21883086 TATGTGTCCCATGTGCATCTTGG - Intronic
1202158073 Y:21906605-21906627 TATGTGTCCCATGTGCATCTTGG - Intronic