ID: 1064286798

View in Genome Browser
Species Human (GRCh38)
Location 10:13998671-13998693
Sequence GATTGGGTGTGGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 1, 1: 0, 2: 5, 3: 80, 4: 764}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064286798 Original CRISPR GATTGGGTGTGGAGGGAGAA AGG (reversed) Intronic
900335651 1:2161753-2161775 GTTCGGGTCTGGATGGAGAAGGG - Intronic
901364501 1:8734309-8734331 GATTTGGGGTGGGAGGAGAAGGG + Intronic
901779625 1:11585098-11585120 GATGGGGTGGAGAGGGAGCATGG + Intergenic
901896783 1:12320287-12320309 CATGGGGTGTGGAGACAGAAGGG + Intronic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902822186 1:18950208-18950230 TGTTGGGGGTGGAGGGAGAACGG - Intronic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903066191 1:20701001-20701023 GCATCGGTCTGGAGGGAGAAGGG - Intronic
903283222 1:22262051-22262073 GATGGGCTGTGGTGGGAGGATGG + Intergenic
903887794 1:26551115-26551137 GATGGGGTCTGGTGGGAAAAGGG + Intronic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
904608379 1:31711373-31711395 GATTGGGTCTGGAGGAAGTCTGG - Intergenic
904695562 1:32328988-32329010 GATAGGGGCTGGAGGGATAAAGG - Intronic
905012985 1:34759635-34759657 GATTGGGTGGGCAGGCAGGAGGG - Intronic
905105220 1:35559744-35559766 GGTTGTGTGTGGGGGGTGAAGGG + Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905320632 1:37114394-37114416 GAATGGCTGGGGAGGCAGAAGGG - Intergenic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905450482 1:38052903-38052925 GTTTGGGTGGGGTGGGAGGAAGG + Intergenic
905595265 1:39201139-39201161 GATTGGTTGTGGAATGAGCAGGG - Intronic
906300233 1:44676147-44676169 AATTGGGTGTGGGGGAAGTAAGG + Intronic
906306505 1:44723467-44723489 GATTTGGTTAGGAAGGAGAAGGG - Intronic
906670248 1:47649029-47649051 GATAGGGTATGGAGGGAGTCAGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907425111 1:54374656-54374678 GGTGGGGGATGGAGGGAGAAAGG - Intronic
907922297 1:58924893-58924915 GATTGGGTGGGGAGGAATCAGGG - Intergenic
908044138 1:60150242-60150264 GTTTGGGGGAGGATGGAGAAAGG - Intergenic
908122733 1:61001279-61001301 GAGTGGGTGAAGAAGGAGAAGGG - Intronic
908412131 1:63877533-63877555 GATTGGCCCTGGAGGGAGTAGGG + Intronic
908424849 1:63996833-63996855 GATTGGGTGAGGAGAGATCATGG + Intronic
908472256 1:64455776-64455798 GAGGGAGTGGGGAGGGAGAATGG + Intergenic
908486758 1:64602349-64602371 GAATGGGTGTGGAGTAGGAATGG - Intronic
909498272 1:76304331-76304353 GAGGGAGAGTGGAGGGAGAAAGG - Intronic
910344301 1:86218077-86218099 AATTAGGTCTGGAGTGAGAAAGG - Intergenic
910697297 1:90033014-90033036 AATTGTGTGAGGAAGGAGAAAGG - Intronic
910867652 1:91802872-91802894 CATTGGGTGAGGAGAGGGAAGGG - Intronic
911412172 1:97523567-97523589 GAAAGGGCGGGGAGGGAGAAGGG - Intronic
911539110 1:99137210-99137232 GATTTGGTGGGCAGGGAGATAGG - Intergenic
911954174 1:104215195-104215217 GGTTGGCTGTGGTGGGAGAGGGG - Intergenic
912928963 1:113938990-113939012 GATTAGATGTGGAGGAATAAGGG + Intronic
912956122 1:114154961-114154983 GAGTGGCTGGCGAGGGAGAAAGG + Intergenic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
913211483 1:116586275-116586297 TTTTGGATGGGGAGGGAGAAAGG - Intronic
913441782 1:118906335-118906357 CATTGGGGGTGGGAGGAGAAAGG - Intronic
913530262 1:119729066-119729088 GATGGGGAGTGGAGGCAGGAGGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915500721 1:156315111-156315133 AATAGGCTGTGGAGGAAGAACGG - Intronic
916114068 1:161472698-161472720 GGTTGGGCGCGGAGGGAGAGCGG - Intergenic
916171345 1:162003657-162003679 GGTTGGGAGTGGAGAGAGCAGGG - Intronic
916353880 1:163882855-163882877 GATTGGATATGGAGCAAGAAGGG - Intergenic
916937563 1:169645247-169645269 GTATGCGTGTGGTGGGAGAAAGG - Intergenic
917130849 1:171741497-171741519 GATTGGGTGTGGGGGGTGAACGG - Intronic
917192216 1:172430016-172430038 GAAGGGGTGTAGAGGGAGAAGGG + Intronic
917241697 1:172955716-172955738 GATGGGGTGGGGAGGGAGGTTGG + Intergenic
917612399 1:176701896-176701918 GATTGTGTGGTGAGGGTGAAAGG - Intronic
917961597 1:180149948-180149970 ATGTGTGTGTGGAGGGAGAAGGG - Intergenic
917990160 1:180367536-180367558 GCTTGAGGGTGGAGGGTGAAGGG - Intronic
918401413 1:184165958-184165980 GTTTGTTTGTGGAGGGGGAAGGG + Intergenic
918576196 1:186063401-186063423 GAGGGAGTGGGGAGGGAGAAAGG + Intronic
919292640 1:195652194-195652216 GATTGTGTGTGGATGGGGATGGG + Intergenic
919673955 1:200362992-200363014 GATGGGGTGGGGTGGGATAAAGG - Intergenic
919977242 1:202620569-202620591 GATGGGGAGTGCAGGGGGAAGGG + Intronic
920122686 1:203670615-203670637 TATAGGGTGGGAAGGGAGAAGGG - Intronic
920254489 1:204645084-204645106 GATGGGGTGGGGATGAAGAAGGG + Intronic
920510098 1:206544695-206544717 GGTTGGGGGTGTAGGCAGAAAGG - Intronic
920701265 1:208219566-208219588 AATGGGGAGTTGAGGGAGAAAGG - Intronic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
921582899 1:216915436-216915458 GATGGGGTGGAGAGGAAGAAGGG + Intronic
922062925 1:222108771-222108793 AATTGGTGGTGGTGGGAGAAGGG - Intergenic
922352914 1:224749250-224749272 GATTTGATATGGAGAGAGAATGG - Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922501589 1:226100811-226100833 GCTGGGCTGTGGAGGAAGAACGG + Intergenic
923022855 1:230178353-230178375 GATTGGGAGTGGACTGAGCATGG + Intronic
923045509 1:230352808-230352830 GAATGGGAGGGGATGGAGAAGGG + Intronic
923078378 1:230630577-230630599 GAATTGGTGTGGAGAGAGAAGGG + Intergenic
923129916 1:231066249-231066271 GACTGGGTGTGGAGTGGGAGAGG - Intergenic
923610954 1:235493222-235493244 GATTGGATGTGGCAGGTGAAAGG + Intronic
923814431 1:237359635-237359657 GATGGAGAGGGGAGGGAGAAAGG - Intronic
923838098 1:237637020-237637042 GACTAGGTGTGTGGGGAGAAAGG + Intronic
924162389 1:241246148-241246170 GATGGGGTGTGGATGAAGACTGG + Intronic
924581898 1:245330559-245330581 GAGAGGGAGTGGAGGGAGAGTGG + Intronic
1063249206 10:4255314-4255336 GATTGGATGTGGAGAGAGAGAGG - Intergenic
1063249506 10:4258587-4258609 GATTGGGTGTGGAGCTGGGATGG + Intergenic
1063362402 10:5469160-5469182 GGGAGGGAGTGGAGGGAGAAAGG - Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063580274 10:7300169-7300191 GATGGGGAGTGGAGGGGGAACGG + Intronic
1063646141 10:7885502-7885524 GATTCGGTGAGGAGGGAAATGGG - Intronic
1063749958 10:8932862-8932884 GATTGGGATTGGTGGGAGAGAGG + Intergenic
1063781188 10:9327153-9327175 GTTTGGGTGAGGAGAGGGAAAGG + Intergenic
1064106996 10:12508702-12508724 GTTTAGTTGGGGAGGGAGAAAGG - Intronic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064770637 10:18718876-18718898 GATTGTGTGTGAAAGGAGGAAGG + Intergenic
1065281623 10:24144865-24144887 GAATGTGAGGGGAGGGAGAAAGG - Intronic
1065428321 10:25628653-25628675 ACTTGAGGGTGGAGGGAGAAGGG - Intergenic
1065805533 10:29390508-29390530 GGTTGGAGGTGGTGGGAGAAAGG + Intergenic
1065943135 10:30583153-30583175 GGTTGGAGGTGGTGGGAGAAAGG - Intergenic
1066195117 10:33091516-33091538 TACTTGGTGGGGAGGGAGAAGGG + Intergenic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1067146646 10:43699057-43699079 AACTGGGTGTGGAGGGAGAGGGG + Intergenic
1067222453 10:44353773-44353795 CATCGGGTGTGGAGGTAGAAAGG - Intergenic
1067283479 10:44890757-44890779 GGATGGGTGTGGTGGGAGACAGG + Intergenic
1067361008 10:45578461-45578483 AATGGGATGTGGAGGGAGGAGGG + Intronic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1069538151 10:69270963-69270985 CATTGGGTGAGGAAGAAGAATGG - Intronic
1070279013 10:75035376-75035398 GAGTGGGAGTGGAAGGAGAGGGG - Intergenic
1071399705 10:85257254-85257276 GATTGGATGTGGAGGGCAGAGGG - Intergenic
1071482750 10:86077532-86077554 GATTGCGTCTGCAGGGAGCAGGG - Intronic
1071629218 10:87204392-87204414 GATTGGGGGTGGTGGGAGGGGGG + Intergenic
1071864171 10:89707648-89707670 AATTGGGTGTGAAGGGGGAAAGG - Intronic
1071870992 10:89794534-89794556 GGTCGGGAGTGGAGGGACAAGGG - Intergenic
1072636989 10:97184880-97184902 GGCTGGGTGTGGAGGGAGGCGGG + Intronic
1072737775 10:97890605-97890627 GATTGGGAGTGCAGAGAGGAAGG - Intronic
1072897181 10:99376997-99377019 GGATGGGTGGGGAGGAAGAAGGG - Intronic
1073428524 10:103471186-103471208 GATAGGGTGTGGAGGAAGGAGGG - Intergenic
1073496609 10:103897324-103897346 GATTAGGTAAGGAGGAAGAAGGG + Intronic
1073500591 10:103933321-103933343 GGTTGGGAGGGGAGGGAGACGGG + Intergenic
1073825107 10:107311906-107311928 GATTAGTCTTGGAGGGAGAATGG + Intergenic
1074220902 10:111436735-111436757 TGTTGGGTGTGGAGGGTGATAGG - Intergenic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1074763853 10:116686526-116686548 GAGTTGGTGTGAAGGAAGAAAGG + Intronic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1076571958 10:131438913-131438935 GAGGGAGGGTGGAGGGAGAAGGG - Intergenic
1076604157 10:131678390-131678412 GGTTGGGTGTGGGTGGGGAATGG + Intergenic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076706603 10:132305635-132305657 GATTCAGTTTGGAAGGAGAAAGG - Intronic
1076824323 10:132959605-132959627 GATTGGGTGGGGAGGAGCAAAGG - Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077611674 11:3646800-3646822 GATCGGGTTTGGAGGGGAAATGG - Intronic
1077750806 11:4966452-4966474 GATTAGATATGGAGGGTGAATGG + Intronic
1077791442 11:5444729-5444751 GCTTGTGTGTGGTGGGAGGAGGG + Intronic
1077975122 11:7239755-7239777 GATTGGATTAGGAGGGAGAAGGG + Intronic
1078353895 11:10618958-10618980 GGTTGGGAGTGCAGGGAGAGGGG + Intronic
1078461663 11:11519532-11519554 GAATGGATGTGGAGGGCAAAGGG + Intronic
1078588918 11:12620813-12620835 GATTTGGTGTGGAAGGTGGATGG + Intergenic
1078612747 11:12835829-12835851 TTTTGGGGGTGGATGGAGAAAGG + Intronic
1078748589 11:14138841-14138863 GTTTGGGTGTGGAGAGATCAAGG - Intronic
1078778428 11:14414879-14414901 GATCGGAGGTGGAGGGAGCAGGG + Intergenic
1079023585 11:16927973-16927995 AATTGTGTGTGGAGGGGGAAGGG + Intronic
1079125430 11:17715006-17715028 GGTTGGGGGCGGAGGGAAAAAGG - Intergenic
1080696691 11:34608892-34608914 GCCTGGGTGGGGAGGGCGAAAGG + Intergenic
1081559231 11:44197537-44197559 TATTGGGTTTGGGGAGAGAATGG + Intronic
1082968364 11:58992142-58992164 AATTGAGTGAGTAGGGAGAAAGG + Intronic
1082973510 11:59049394-59049416 GGTTGAGTGGGTAGGGAGAAAGG + Intergenic
1083233862 11:61339632-61339654 GATTGGGTGTGGAGAAGAAAAGG - Intronic
1083365647 11:62140156-62140178 GAATGGGGGTGTAGGGGGAAGGG - Intronic
1083841145 11:65304972-65304994 GGGTGGGGGTGGGGGGAGAATGG - Intronic
1083860667 11:65418386-65418408 GTTTGGGGGTGGGGGGGGAATGG + Intergenic
1085009538 11:73128577-73128599 GATGGGGGAAGGAGGGAGAAAGG + Intronic
1085471126 11:76758776-76758798 GAGAGGGTGTGGAGTGAGGAAGG + Intergenic
1085784090 11:79436741-79436763 GTTTGGGGGTGGAGGTAGAGTGG - Intronic
1085825625 11:79844125-79844147 GATGGGGTAAGGAGGGAGAGAGG - Intergenic
1086070190 11:82791212-82791234 GCTGGGGTGTGGTGGGAGAGGGG - Intergenic
1086542710 11:87931946-87931968 GGTGGGGTGGTGAGGGAGAATGG + Intergenic
1086755709 11:90558837-90558859 GGTGGGGTGTGGAGGGAAAGGGG + Intergenic
1087079036 11:94152118-94152140 CATAGGGTGGGAAGGGAGAATGG + Intronic
1087944006 11:104136045-104136067 GATGGGATGAGGAGGGAGAGAGG + Intronic
1088463906 11:110112690-110112712 GACTGGGAGTGGAGAGTGAAAGG - Intronic
1088541060 11:110914030-110914052 TATTGGGAGTGAAGGGAGAGAGG - Intergenic
1089300525 11:117496054-117496076 GATTGGGTTTGGAAGGGCAAAGG - Intronic
1089418878 11:118316059-118316081 GAGGGGGGGTGGAGGGAGTAGGG - Exonic
1090444993 11:126756731-126756753 CATTGGGAGTGGAGGTGGAATGG - Intronic
1090589543 11:128250639-128250661 GATTGGGAGTGCATGGAGAAGGG + Intergenic
1090691724 11:129190203-129190225 GCATGGGTGTGGAAGGGGAAGGG - Intronic
1090935909 11:131342078-131342100 GAGGGGGTGTGGAAGGAGCAGGG + Intergenic
1090968145 11:131616258-131616280 TCTTGGGTGAGGAAGGAGAAAGG - Intronic
1090982008 11:131731177-131731199 GATTGGATGTGGAGAGATAAGGG - Intronic
1091001504 11:131913691-131913713 GTTTGGGTGTGGATGGAGATGGG + Intronic
1091062494 11:132476686-132476708 GTTTTGGGGTGGAGGGAGCAGGG + Intronic
1091226182 11:133957493-133957515 GTCTGGGTGCGGAGGGAGACGGG - Intergenic
1091455919 12:607793-607815 GACTGGGGGTGGAAGGGGAATGG + Intronic
1091584089 12:1806024-1806046 GCTGGGGTGTGGAGGGAGCAGGG + Intronic
1092589737 12:9941292-9941314 AATAAGGTGAGGAGGGAGAATGG + Intergenic
1092589884 12:9943182-9943204 GGTTGGAGATGGAGGGAGAAGGG - Intergenic
1093401879 12:18755418-18755440 GATTTGATGTGGAGAGAGTATGG + Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093823536 12:23652700-23652722 TATTGGCCGTGGAGGGTGAAAGG - Intronic
1094210607 12:27885934-27885956 GGTTGGTTGTGGAGGGATGAAGG + Intergenic
1094234619 12:28149321-28149343 GATGGGGAGTGGAGGCAAAATGG - Intronic
1095289498 12:40461558-40461580 GATTGGGAGGGAAGCGAGAAAGG - Intronic
1095587984 12:43869907-43869929 TATGGGGGGTGGTGGGAGAAGGG - Intronic
1095589486 12:43887825-43887847 GACTGGGTGTGGAAGGAAAGGGG + Intronic
1096110036 12:49023118-49023140 GGTGGGGTGTGGAGGGAGATGGG + Intronic
1096225667 12:49865454-49865476 GAATGGGTGGTGAGGCAGAAGGG + Intergenic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1097250955 12:57632143-57632165 GGTAGGGTGGGGAGTGAGAAAGG + Intronic
1098008633 12:66026156-66026178 GGTGGGGTGTAGAGGGAGAGAGG + Intergenic
1098776517 12:74627028-74627050 GCTTGAGGGTGGAGGGAGGAGGG - Intergenic
1099785689 12:87260432-87260454 ATTTGTGTGTGAAGGGAGAAAGG - Intergenic
1099817057 12:87662981-87663003 GATTTGGTGTGTAGTGAGCAAGG + Intergenic
1100031360 12:90196116-90196138 GATTGGGCTTGGAGGCAGAGAGG + Intergenic
1101570197 12:105946583-105946605 GATGGGGAGTGGGGGTAGAAGGG + Intergenic
1101794610 12:107961356-107961378 TATTGGGGGTGGGGGGTGAAGGG - Intergenic
1102221680 12:111199052-111199074 GGGTGGGTGCGGAGAGAGAAGGG + Intronic
1102263156 12:111457775-111457797 TATTGGGTGTGGTGGGGGATGGG + Intronic
1102598616 12:114012477-114012499 GTTTGTGTGTGGAGTGAGAGAGG + Intergenic
1102812199 12:115833998-115834020 GATTGGGTGTGTAACGAAAAGGG - Intergenic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1102987969 12:117294112-117294134 AACTGGGTATGTAGGGAGAATGG - Intronic
1103218536 12:119223555-119223577 GATCGGGGTTGCAGGGAGAAAGG + Intergenic
1103362953 12:120364472-120364494 GCTTGTGTGTGTTGGGAGAAAGG - Intronic
1103437119 12:120935519-120935541 GGTTGGGGGTGGTGAGAGAATGG - Intergenic
1103553363 12:121751400-121751422 GATAGGGTGTGGGGTGAGAGTGG - Intronic
1104579768 12:130002676-130002698 GAATGGGTCTAGAGGGATAAAGG - Intergenic
1104841835 12:131829294-131829316 TACTGGGTGTGGAGTGAGGAAGG - Intronic
1104860563 12:131921289-131921311 GCTTGCCTGTGGAGGGAGAGGGG - Exonic
1104882260 12:132080754-132080776 GACTGGGTGTGGAAGGACACTGG - Exonic
1104882268 12:132080794-132080816 GACTGGGTGTGGAAGGACACTGG - Exonic
1104882276 12:132080834-132080856 GACTGGGTGTGGAAGGACACTGG - Exonic
1104882284 12:132080874-132080896 GACTGGGTGTGGAAGGACACTGG - Exonic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105260164 13:18773172-18773194 GGTTGGGGGTGGAAGGAAAAGGG - Intergenic
1105406901 13:20140678-20140700 GCTCTGGTGTGGAGGCAGAATGG + Exonic
1105891746 13:24687055-24687077 GAATTGGAGTGGAGGGAGATGGG + Intronic
1106590124 13:31091626-31091648 GACTGGGTGTGGGAGGAGGAGGG - Intergenic
1106795465 13:33200507-33200529 GGTTAGGTGTGGAAGGAGCAGGG - Intronic
1107302508 13:38980368-38980390 GAGTGAGTGGGGAGAGAGAAAGG - Intronic
1107372344 13:39766533-39766555 GATGGGGTTAGGAGGGAGTATGG - Intronic
1107372352 13:39766556-39766578 GATGGGGTTAGGAGGGAGTATGG - Intronic
1107404163 13:40097367-40097389 AATGGGGTGTGGAGGGGGAGGGG + Intergenic
1107622094 13:42244034-42244056 GATTGGCTGTGGATGGATGAGGG + Intronic
1107720661 13:43245054-43245076 GGTTGGGGGAGGATGGAGAATGG + Intronic
1108214870 13:48174378-48174400 GATCGGATGTGGAGGGTGAGAGG - Intergenic
1108559158 13:51626255-51626277 GATAGGGTTTGGAGTGAGACTGG + Intronic
1108648278 13:52451361-52451383 GAGTTGGGGTGGAGGGGGAAAGG - Intergenic
1108956303 13:56162507-56162529 GGTTGGGTGGGGAGTGAGAGAGG + Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1109881812 13:68487839-68487861 AAGTGGGTGGGGAAGGAGAAAGG - Intergenic
1110445316 13:75573608-75573630 GAGGGGGTGTGGAGAGAGACGGG + Intronic
1112759696 13:102680473-102680495 AGCTGGGGGTGGAGGGAGAAAGG - Intergenic
1113106102 13:106772851-106772873 GTGTGTGTGTGGAGGGAGAGGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113735948 13:112679208-112679230 GATTGGGAATGGAAGAAGAAAGG - Exonic
1113899662 13:113789094-113789116 GATAAGGTGGGGAGGGAGAGTGG - Intronic
1113952035 13:114077466-114077488 CATTGAGTGGGGAGGGAGGAAGG - Intronic
1114271144 14:21101046-21101068 GATGGGGTGTGGTGGGGCAAAGG - Intronic
1114519353 14:23323162-23323184 TTTTGGGTGTGGAGGGAGTGTGG + Intronic
1114768106 14:25397753-25397775 GATTGTGTGTGCTGGGAAAAAGG + Intergenic
1114884089 14:26826004-26826026 GAGTGGATGTGGAGAGTGAATGG - Intergenic
1115498244 14:34027357-34027379 GATGGGGAGGGGAGGGAGAGGGG + Intronic
1115707175 14:36011312-36011334 GCTGGAGAGTGGAGGGAGAAGGG - Intergenic
1116019915 14:39447701-39447723 GATTGGATGTGGGGTGTGAAGGG + Intergenic
1116778742 14:49212453-49212475 CATTGGGTGTTGAGGAGGAATGG - Intergenic
1117025517 14:51616114-51616136 GGTTGGGGGTGGATGTAGAAAGG + Intronic
1117258070 14:54000626-54000648 GGTTGAGAGTGTAGGGAGAAAGG - Intergenic
1117314542 14:54561002-54561024 GAGTGGGAGTGGCGTGAGAAAGG + Intergenic
1117516028 14:56502140-56502162 GCTGGGGTGTGGAGGGTGGAGGG - Intronic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118335029 14:64846158-64846180 GCTTCTGTGTGTAGGGAGAAGGG - Intronic
1118353292 14:64989925-64989947 GAATGGGTGGGGTGGGAGCAGGG + Intronic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1119195788 14:72715830-72715852 GGTGGGGTGGGGAGGGAGACTGG - Intronic
1119476395 14:74932513-74932535 GATTGGGTGTGGGAGGGGGAAGG + Intergenic
1119685581 14:76628430-76628452 GATTGTGGGTGGAGAGAGACTGG - Intergenic
1120080589 14:80211577-80211599 GGTTGGGGGTTGGGGGAGAAGGG + Intronic
1121698848 14:95936423-95936445 GGTTGGTGGTGGGGGGAGAAGGG - Intergenic
1122038531 14:98965422-98965444 AAAGGGGTGAGGAGGGAGAAGGG - Intergenic
1122046825 14:99029880-99029902 CACTGTGTGTGGAAGGAGAAGGG + Intergenic
1122179874 14:99947130-99947152 GTTGGGGTGTGGAGAGAGAAAGG + Intergenic
1124143399 15:27097535-27097557 GATTGGGAGTGGTTGGAAAAAGG - Intronic
1124492905 15:30168950-30168972 GATGGGGAGTGCAGGGGGAAGGG + Intergenic
1124667399 15:31605182-31605204 GTGTGGGTGTGCAGGGGGAATGG + Intronic
1124750629 15:32369375-32369397 GATGGGGAGTGCAGGGGGAAGGG - Intergenic
1125202083 15:37108955-37108977 TATGGGGTGTGGAGGGGAAAGGG + Intergenic
1125421656 15:39510487-39510509 GGTAGGGTGGGGATGGAGAAGGG + Intergenic
1125507559 15:40275786-40275808 GAGGGGGTGGGGAGGGACAAGGG + Intronic
1125535079 15:40437867-40437889 GGTTGTGTGTGGTGGGGGAAGGG + Intergenic
1125679081 15:41519683-41519705 GAATTGGTGAGGAGGTAGAAAGG - Intronic
1125751774 15:42033947-42033969 GATTGGGTGGAGTGGGAGAGAGG + Intronic
1126163198 15:45632644-45632666 GCTTGGATGTGGAGGGTGATGGG + Intronic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1126951553 15:53887169-53887191 GTTTGTGTGTGGAAGGAGAAGGG + Intergenic
1127117249 15:55741615-55741637 GATTGGGGGTGAATGGAGAATGG + Intronic
1128109372 15:65067191-65067213 GAGGGGGTGTGGAGGGGGAGGGG + Intronic
1128283810 15:66419166-66419188 GATGGAGTTTGGAGGGAGAGGGG - Intronic
1128403230 15:67307520-67307542 GAGTGGGAGTGGAGAAAGAAGGG + Intronic
1129714408 15:77838645-77838667 GATTGCGGGTGGGGGTAGAAGGG - Intergenic
1129919948 15:79311443-79311465 ACCTGGGAGTGGAGGGAGAAGGG - Intronic
1129943457 15:79518821-79518843 GATTGGATGGGGAGTGAGAAAGG - Intergenic
1130158016 15:81370058-81370080 GATTGGGTGTGGAGGTAGCAGGG + Intronic
1130559229 15:84945469-84945491 GTTTGGATGTGGAGGGGAAACGG - Exonic
1130733288 15:86521819-86521841 GCTTGGGTGTGGAAGGACAATGG + Intronic
1130745855 15:86653242-86653264 GACTTGGTGTGGAGGGAGCTTGG - Intronic
1130813025 15:87402275-87402297 GATTGGATGTGTAGGGAGAAGGG + Intergenic
1131187961 15:90291974-90291996 CATGGGGTGTGGAGGGAGGCGGG - Intronic
1132066786 15:98737776-98737798 GAGGAGGTGTGGAGGGGGAAGGG + Intronic
1132248234 15:100314446-100314468 AAATATGTGTGGAGGGAGAAAGG + Intronic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132496717 16:266829-266851 GGGTGGGGCTGGAGGGAGAAGGG + Intronic
1132919398 16:2377458-2377480 GTTTGGGGGTGGGGGGGGAAGGG - Intergenic
1133387996 16:5386309-5386331 GACCAGGTGTGGATGGAGAAGGG + Intergenic
1133744375 16:8675495-8675517 GATTGGGAGCGGTGGGAGGATGG - Intronic
1133883457 16:9804618-9804640 TATAGGGAGTGGAGGCAGAAAGG - Intronic
1134175519 16:12002996-12003018 GATCCGCTTTGGAGGGAGAAAGG + Exonic
1134755445 16:16663343-16663365 GGTCTGATGTGGAGGGAGAATGG + Intergenic
1134764174 16:16742015-16742037 GGTTGGGAGTGGGAGGAGAAGGG + Intergenic
1134981883 16:18617201-18617223 GGTTGGGAGTGGGAGGAGAAGGG - Intergenic
1134990621 16:18695827-18695849 GGTCTGATGTGGAGGGAGAATGG - Intergenic
1135042204 16:19126361-19126383 GGCTGGGTGTGGGGGGAGGATGG - Intronic
1135410807 16:22232971-22232993 TATTGGGTGTGGATTGTGAAAGG + Intronic
1135668364 16:24354425-24354447 GCTGGGCTGAGGAGGGAGAATGG + Intronic
1136037450 16:27550568-27550590 GAATTGGTGTGGGGGGTGAAGGG + Intronic
1136106319 16:28032754-28032776 AATTGGATGTGGAGTGAGAGGGG - Intronic
1136281302 16:29213087-29213109 GGTTGGGGGTGCAGGGAGGACGG - Intergenic
1136476409 16:30516548-30516570 GATTGGAGGTGGAGTAAGAATGG + Intronic
1137488925 16:48914420-48914442 GAATGGGGGTGGGGAGAGAATGG + Intergenic
1137589798 16:49686622-49686644 GCCTGGGTGTGGTGGGAGAGGGG - Intronic
1137622734 16:49886855-49886877 TATAGGGTGTGCAGGGAAAATGG - Intergenic
1138342776 16:56301578-56301600 GCATGTGTGTGGAGGGAGATTGG + Intronic
1139308151 16:66005739-66005761 AAGTGGGTGGGGAGCGAGAAAGG - Intergenic
1139370905 16:66468928-66468950 GATGTGGTGTGGTGGGAGCAAGG - Intronic
1139469048 16:67168691-67168713 GGTTGGGGGTGGAGAGAGGATGG + Intronic
1140200011 16:72887505-72887527 GACTGAGTGTGGAGGGAGCTGGG + Intronic
1141493549 16:84391007-84391029 GAGTGGGTGAGGCAGGAGAATGG + Intronic
1141812399 16:86384296-86384318 GATTGGCTTTAGAGGGAGATGGG + Intergenic
1142018485 16:87765480-87765502 GAGGGAGGGTGGAGGGAGAAGGG + Intronic
1142085671 16:88179015-88179037 GGTTGGGGGTGCAGGGAGGACGG - Intergenic
1142212770 16:88816321-88816343 GATTGGGTGTGGAAGGCAGAAGG + Intronic
1143166110 17:4897974-4897996 GGGTGGGGGGGGAGGGAGAAGGG - Exonic
1143174567 17:4948739-4948761 GATGGGGGGTGGCGGGAGAGAGG + Exonic
1143181982 17:4989063-4989085 AATTGGGAGTGGAGGGTTAAAGG - Intronic
1143473298 17:7189841-7189863 ACCTGGGTGTGGAGGGAGATGGG - Intergenic
1143595777 17:7912664-7912686 GAGTGGGTGTGAAGAGAGACTGG - Exonic
1143622852 17:8090959-8090981 GGTTGGGTGGGGAGGGAGGGAGG + Intergenic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1145204283 17:20973406-20973428 GTTTGTGTGTGGTGTGAGAAAGG + Intergenic
1145754848 17:27382802-27382824 GATTGGGGGTGGGGGGATAGTGG + Intergenic
1145790933 17:27626093-27626115 GATTTGGTGTGGGGGGAGGGTGG + Exonic
1146036542 17:29411858-29411880 GATTGGTTATTAAGGGAGAAGGG - Intronic
1146328798 17:31910395-31910417 GATCTGGAGTGGAGGGAGCAAGG - Intergenic
1146651567 17:34610011-34610033 GATTGGGTGTGGTGGGACCTGGG - Intronic
1146884741 17:36463625-36463647 CATTGAGGGTGGAGGGAGGAAGG + Intergenic
1146979501 17:37146688-37146710 GATTTGGAGAGGAGAGAGAAAGG + Intronic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1147510108 17:41060720-41060742 ATTTGGGGGTGGAGGGGGAAAGG + Intergenic
1147638415 17:41978484-41978506 GGTTGGGGTTGGAGGGAGTAAGG - Intronic
1147686747 17:42290474-42290496 GAGTGGGTATGGAGGAAGAGAGG + Intronic
1147697402 17:42366324-42366346 GATTAGGTGTGGCAGGAGGAGGG - Intronic
1148233307 17:45950565-45950587 GAGATGGGGTGGAGGGAGAAGGG - Intronic
1148425204 17:47589258-47589280 GACTGGTTGGGGATGGAGAATGG + Intronic
1148555927 17:48578536-48578558 GGGTGGGTGGGGAGGGGGAAGGG - Exonic
1148560756 17:48604521-48604543 GAATGGGTGGGGAGGAAGGAAGG + Exonic
1148562677 17:48614761-48614783 GAGGGGGTGGGGAGGGGGAAAGG + Exonic
1148864509 17:50621504-50621526 GAAAGGGTGGGGAGAGAGAAGGG + Intronic
1150092830 17:62344312-62344334 GATTTGATGTGGTGGGTGAAAGG + Intergenic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1150643285 17:66964000-66964022 GACTTGGGGTTGAGGGAGAAGGG - Intergenic
1150653571 17:67025156-67025178 GACTGGGGGTGGATGGAGAATGG + Intronic
1151091343 17:71443611-71443633 TATTGGGTGTTGGGGGAGCAGGG - Intergenic
1151482128 17:74376208-74376230 GGTAGGCTATGGAGGGAGAAGGG - Intergenic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1151595325 17:75074883-75074905 GTTTGTGGGTGGAGGGAGAGTGG - Intergenic
1151848949 17:76678316-76678338 GGATGGGTGTGGAGGAAGACTGG + Intronic
1152147219 17:78575620-78575642 GCTGGGGGCTGGAGGGAGAAAGG - Intronic
1152257178 17:79246859-79246881 GGATGGGGGTGGGGGGAGAACGG + Intronic
1153410526 18:4787872-4787894 AGTTGGGAGTGGAGGGAGAGTGG + Intergenic
1153580857 18:6571941-6571963 GATGGGATGTGCAGAGAGAAAGG - Intronic
1153871367 18:9323410-9323432 TATTGGGGGAGGAGGGAGACAGG - Intergenic
1154425863 18:14271628-14271650 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1154433552 18:14326870-14326892 GGTTGGGGGTGGAAGGAAAAGGG + Intergenic
1155069376 18:22300488-22300510 GATTGGGTGGGGTGGGGGGAGGG - Intergenic
1155103771 18:22640541-22640563 GCTTGGGTGTGCAGTGAAAATGG - Intergenic
1155108451 18:22689936-22689958 GAGTGAGTGTGAATGGAGAAAGG - Intergenic
1156001435 18:32389053-32389075 CATTTGGTGGGGAGGGAGGAGGG + Intronic
1156403855 18:36765123-36765145 GATGGGGGTTGGAGGGAGGAAGG + Intronic
1156579105 18:38354828-38354850 GAGTAGTTGTTGAGGGAGAAGGG + Intergenic
1158403938 18:57144778-57144800 GGGTGGGTGTGGTGGGGGAATGG + Intergenic
1158610475 18:58935407-58935429 GAGTGGGGGAGGAGGGAGAGGGG - Intronic
1158829298 18:61260203-61260225 GGTGGGGTGGGGAGAGAGAAAGG - Intergenic
1158847596 18:61461409-61461431 TAGTGGCTGTGGAGGGAGCATGG - Intronic
1158852779 18:61512605-61512627 GATTTATTGTGTAGGGAGAATGG - Intronic
1160403919 18:78631462-78631484 GATTGGGGGAGGAGGGGGTAAGG - Intergenic
1160451831 18:78971693-78971715 GCTTGGATGTGGAAGGAGAGTGG - Intergenic
1160503971 18:79417124-79417146 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160503976 18:79417141-79417163 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160503981 18:79417158-79417180 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160503986 18:79417175-79417197 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160503993 18:79417199-79417221 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504000 18:79417223-79417245 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504005 18:79417240-79417262 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504012 18:79417264-79417286 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504017 18:79417281-79417303 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504024 18:79417305-79417327 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504030 18:79417329-79417351 GATCGGCTGTGGTGGGAGATGGG + Intronic
1160504042 18:79417369-79417391 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504049 18:79417393-79417415 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504054 18:79417410-79417432 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504061 18:79417434-79417456 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504068 18:79417458-79417480 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504074 18:79417482-79417504 GATCGGCTGTGGTGGGAGATGGG + Intronic
1160504086 18:79417522-79417544 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504093 18:79417546-79417568 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504098 18:79417563-79417585 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504105 18:79417587-79417609 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504110 18:79417604-79417626 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504117 18:79417628-79417650 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504123 18:79417652-79417674 GATCGGCTGTGGTGGGAGATGGG + Intronic
1160504135 18:79417692-79417714 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504142 18:79417716-79417738 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504149 18:79417740-79417762 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504154 18:79417757-79417779 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504161 18:79417781-79417803 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504166 18:79417798-79417820 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504173 18:79417822-79417844 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504179 18:79417846-79417868 GATCGGCTGTGGTGGGAGATGGG + Intronic
1160504191 18:79417886-79417908 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504198 18:79417910-79417932 GATGGGCTGTGGTGGGAGATGGG + Intronic
1160504209 18:79417951-79417973 GATGGGCTGTGGCGGGAGATGGG + Intronic
1160682467 19:418092-418114 GGTAGGGTGTGGACGGAGGAGGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160975533 19:1790549-1790571 GAGGGGCAGTGGAGGGAGAAGGG - Intronic
1161088712 19:2347159-2347181 GCGTGTGTGTGGAGAGAGAACGG - Intronic
1161088719 19:2347249-2347271 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088726 19:2347343-2347365 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088735 19:2347468-2347490 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088742 19:2347562-2347584 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088749 19:2347656-2347678 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088756 19:2347750-2347772 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088762 19:2347834-2347856 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088765 19:2347875-2347897 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088783 19:2348110-2348132 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088785 19:2348153-2348175 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088787 19:2348196-2348218 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088790 19:2348237-2348259 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088808 19:2348472-2348494 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088814 19:2348562-2348584 GAGTCTGTGTGGAGAGAGAACGG - Intronic
1161088819 19:2348654-2348676 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088821 19:2348697-2348719 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088836 19:2348973-2348995 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088857 19:2349292-2349314 GCGTGTGTGTGGAGAGAGAACGG - Intronic
1161088879 19:2349689-2349711 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088883 19:2349775-2349797 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088900 19:2350182-2350204 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088903 19:2350225-2350247 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088907 19:2350315-2350337 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088911 19:2350407-2350429 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161103009 19:2430602-2430624 GCTTGGGCTTGGAGGGAGGAGGG - Exonic
1161234207 19:3189986-3190008 GAGTGAGCGAGGAGGGAGAAGGG - Intronic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1162129546 19:8517611-8517633 GATGGGGTGAGGTGGCAGAAGGG + Intergenic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163535575 19:17874418-17874440 GATGGGGAGAGGAGGCAGAAGGG - Intronic
1164588716 19:29494582-29494604 GAAAGGGTGGGGAGGGAGAGCGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165152818 19:33770987-33771009 GATGGGGTGTGGAGAGAGAGTGG + Intronic
1165662814 19:37597212-37597234 GTTTGGGTACTGAGGGAGAAGGG + Intronic
1165799226 19:38537431-38537453 GATTGGGCTGGGAGGGATAAGGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166182023 19:41116024-41116046 GATGGGGAAGGGAGGGAGAAAGG - Intronic
1166218307 19:41350786-41350808 GGCTGGGTGGGGAGGGAGACTGG - Intronic
1166569465 19:43784653-43784675 AATGGGGAGTGGAGGGAGAGAGG + Intergenic
1167001278 19:46746758-46746780 GTTTGGGTGTGGAAGGGGTAAGG - Exonic
1167007211 19:46783879-46783901 GGTTGGGGGGTGAGGGAGAAAGG + Intronic
1167348686 19:48962282-48962304 GAATGGGAGTGGGGGGAGGAGGG + Intergenic
1167753418 19:51394761-51394783 GATAGGGAGTGGAGAGTGAAAGG - Intergenic
1167797154 19:51716914-51716936 GATGGGGTGGAAAGGGAGAAGGG - Intronic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925402106 2:3582158-3582180 AATGGGGGGTGGGGGGAGAAGGG - Intergenic
925617286 2:5755689-5755711 GTTGGGGTGTGGAGGGAGTGGGG + Intergenic
925745997 2:7044298-7044320 AACTGGGGGTGGAGGGAGAAAGG + Intronic
926523627 2:13949007-13949029 GATTGGGTGTAGAGAGATGATGG - Intergenic
926554792 2:14344170-14344192 ATTTGTGTGGGGAGGGAGAAAGG - Intergenic
928634329 2:33227746-33227768 GATTTGATGTGGATGAAGAAAGG + Intronic
929166782 2:38890379-38890401 GATTAGGGATGGAGGGAGATTGG + Intronic
929546546 2:42858532-42858554 ACTTGGGTGTGGAGGGAGCAGGG + Intergenic
929854183 2:45621918-45621940 GGTTGGGGGTGGAGGGTCAAGGG - Intergenic
930036999 2:47092548-47092570 GAAAGGGAGGGGAGGGAGAAGGG + Intronic
930037007 2:47092565-47092587 GAAGGGGAGGGGAGGGAGAAGGG + Intronic
930037015 2:47092582-47092604 GAAGGGGAGGGGAGGGAGAAGGG + Intronic
930752211 2:54945085-54945107 GAGTGGGAGAGGAGGGAGAGAGG - Intronic
930844190 2:55883950-55883972 GTTTGGGTGTTGGTGGAGAAAGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931653536 2:64489663-64489685 GAAGGGGTGGGGAGGGAAAAAGG + Intergenic
931786454 2:65623266-65623288 GATTGGCTGTGGATAGAGAGTGG + Intergenic
932338317 2:70943558-70943580 GGTGGGGTGTGGAGAGAGGAAGG + Intronic
932429233 2:71664086-71664108 GAGTGTGTGTGTAGGGGGAAGGG - Intronic
934494382 2:94784520-94784542 GGGTGGGTGTGGACGGAAAAAGG - Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
936777098 2:115986750-115986772 GTGTGGGTGTGGTGGGGGAAAGG + Intergenic
937239888 2:120453218-120453240 GGGTGGGAGTGGAGGGCGAAGGG - Intergenic
938064710 2:128274991-128275013 GAGTTGGGGTGGAGGGGGAATGG + Intronic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
940384612 2:153056041-153056063 GATGGAGTGGGAAGGGAGAAGGG + Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940730778 2:157388510-157388532 GCTTGAGGGTGGAGGGAGGAAGG - Intergenic
940867894 2:158835608-158835630 GAATGGGTGTTGGGGGAGTAGGG + Intronic
940900285 2:159120648-159120670 GATAGGGTGTGGTGGCACAATGG + Intronic
941407341 2:165106984-165107006 GATTGGTTGTGAGGGGTGAAAGG + Intronic
942875265 2:180788081-180788103 GATTGTGTGTTGAAGGATAAAGG + Intergenic
944637210 2:201685982-201686004 GTCTGGCAGTGGAGGGAGAAGGG + Exonic
945205852 2:207331390-207331412 CATAGGGTGTGGAAGGAGAAAGG - Intergenic
945257270 2:207813182-207813204 GGGTGGGGGTGGGGGGAGAAGGG - Intergenic
945699141 2:213149735-213149757 GAAGGGGAGGGGAGGGAGAAGGG - Intronic
946096798 2:217281489-217281511 GGCTGGGTGTGGTGGGAGACCGG - Intergenic
946428649 2:219613302-219613324 GATGGGGTGAGGGGGGAGATGGG + Intronic
946842940 2:223836426-223836448 GTTTGGCTGTGGTTGGAGAATGG - Intronic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947006256 2:225514617-225514639 GATTGTATGTGGAGGTAGAAAGG - Intronic
947263703 2:228252686-228252708 CATTGAGGGTGGATGGAGAAAGG - Intergenic
947591888 2:231390565-231390587 GAGAGGCTGTGGAGGGAGAGGGG + Intergenic
947945918 2:234102106-234102128 GATGGGGTGAGAAGAGAGAATGG + Intergenic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948860728 2:240751479-240751501 ATTAGGGTGTGGAGGGAGCAAGG - Intronic
948884570 2:240876281-240876303 GAGTGGGTGGGCTGGGAGAAGGG + Intronic
1168951574 20:1805444-1805466 GATAGGGTGTGGATGGAGATTGG + Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1169473653 20:5911193-5911215 GATGGTGTGTGGGGGGAGATGGG + Intergenic
1169603649 20:7290884-7290906 GATGGGGTGTGGAGGGGGATAGG + Intergenic
1169789037 20:9390157-9390179 GATTTGGTTTGGGGGGACAAGGG - Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170614429 20:17937507-17937529 GATGGGGTTTGGAGAGGGAATGG - Intergenic
1170792707 20:19521139-19521161 GATTGTGTGGGGAGGGAGGGAGG - Intronic
1170820393 20:19752551-19752573 GGGTTGGTGTGGAGAGAGAATGG + Intergenic
1170953344 20:20956237-20956259 AAATGTGTGTGGATGGAGAAGGG + Intergenic
1171262872 20:23748648-23748670 GATGGGGTGGTGAGGGAGGAGGG - Intronic
1171272003 20:23824852-23824874 GATGGGGTGGTGAGGGAGGAGGG - Intronic
1171791747 20:29532754-29532776 GATTGGATGTGGAGAAAGTATGG + Intergenic
1172049900 20:32109544-32109566 GATTAGGTGAAGAGAGAGAACGG - Exonic
1172762226 20:37330880-37330902 TATTGGATCTGGATGGAGAATGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173858280 20:46265269-46265291 GAGGCGGTTTGGAGGGAGAAGGG - Intronic
1175247833 20:57592128-57592150 GATTTGGGGTGGGGGCAGAAAGG + Intergenic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175495614 20:59412058-59412080 GATTCGGTGTCGGGGGAGCACGG + Intergenic
1175656534 20:60775952-60775974 GATTTGGGATTGAGGGAGAAAGG - Intergenic
1175874301 20:62222140-62222162 GGAGGGGTGGGGAGGGAGAATGG - Intergenic
1175934862 20:62509903-62509925 GGGTGGGCGTGGAGGGCGAAGGG - Intergenic
1176725543 21:10429123-10429145 CATTGGGTGGGGTAGGAGAAGGG + Intergenic
1177071082 21:16509338-16509360 GATGAGGAGTGGGGGGAGAAAGG + Intergenic
1177231702 21:18330148-18330170 GATCGGATGTGGTAGGAGAAAGG - Intronic
1178075262 21:29009913-29009935 TATTTGGTGGGGAGGGAGATAGG - Intronic
1178110054 21:29360895-29360917 GATGGGGATTGGAGGTAGAATGG - Intronic
1178224882 21:30704768-30704790 AATTGAGGGTGGAGGGAGAGAGG - Intergenic
1178973576 21:37202480-37202502 GGTGGGGTGGGGAAGGAGAATGG - Exonic
1179033401 21:37739752-37739774 GATGGGGTGAGGAGGGAGAGAGG + Intronic
1179342094 21:40521720-40521742 GATGGGGAGTGGAGGGTCAATGG + Intronic
1179470510 21:41606934-41606956 GATGGGTTGTGGAGGGACCATGG + Intergenic
1181273134 22:21672519-21672541 GAATGGGTGTGGGGAGAGGAGGG - Intronic
1181528482 22:23502871-23502893 GATTGGGGATGGAGGGTGGAGGG - Intergenic
1182241856 22:28922650-28922672 GACTGGGAGGGGATGGAGAAGGG - Intronic
1182253192 22:29018295-29018317 GATTGGATGTGGAGAGAGGAAGG + Intronic
1183193358 22:36336042-36336064 GATCGGGTGGGAAGGGAGACTGG + Intronic
1183203018 22:36399213-36399235 GATTGGGGAGGGAGGCAGAATGG - Intergenic
1183545184 22:38451683-38451705 GTTTGGGGGTGGAGGAAGCAGGG - Intronic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184149252 22:42628936-42628958 TATGGGGTGTGGAGGCAGAGGGG + Intronic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185151736 22:49167651-49167673 GAGGGGGTGTGGAGGGGTAACGG + Intergenic
1185151746 22:49167681-49167703 GAGGGGGTGTGGAGGGGTAATGG + Intergenic
1185333869 22:50262996-50263018 GGTTGGGGGTGGGAGGAGAATGG - Intergenic
950106405 3:10391756-10391778 GATTGGAACTGGAGGGAGACAGG - Intronic
950139889 3:10608189-10608211 GATGGAGTGAGGAGGGAGACAGG - Intronic
950729964 3:14948139-14948161 GGGTGGGGGTGGAGGGGGAATGG + Intronic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951664251 3:25104391-25104413 GGATGGGGGTGGAGGGAGAGCGG + Intergenic
952339667 3:32434991-32435013 GATTCCCTGTGGAGGGAGACAGG + Intronic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
952627517 3:35424848-35424870 GATTGGATGTGGAGAAAGAGAGG + Intergenic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953393596 3:42548875-42548897 CATTGTGTGTGGGAGGAGAAAGG - Intronic
954196068 3:48997994-48998016 GGTTGGGGGTGGAGTGAGGAGGG + Intronic
954369303 3:50161904-50161926 AAGTGTGTGTGGAGTGAGAATGG + Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
956196777 3:66661112-66661134 GACTGGGTGAGGAGGGTCAAAGG + Intergenic
957192252 3:77024515-77024537 GATCTGGTGTTTAGGGAGAATGG + Intronic
957366761 3:79234820-79234842 GATTGTAGGGGGAGGGAGAAGGG + Intronic
958450261 3:94264698-94264720 GATTTGGAGTGGGGAGAGAAAGG + Intergenic
959752878 3:109858968-109858990 GATTGGTTGTGGGGGGTGGAGGG + Intergenic
960378538 3:116932411-116932433 GGGTGGGTGGGAAGGGAGAATGG - Intronic
961171977 3:124803557-124803579 GACCTGGTGTGGAGGGGGAACGG + Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962409362 3:135127927-135127949 GTTTGGGTGAGGAGGGAGTGTGG - Intronic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962915177 3:139894716-139894738 GGTTGGGTATGGTGGGAGACAGG + Intergenic
963190826 3:142471101-142471123 GACTGGGTGGGGAAGGAGACGGG - Intronic
963522062 3:146367469-146367491 GGTTGGGTATGGAGAGATAATGG - Intergenic
963725044 3:148910390-148910412 GATTGTGTGTTGTGGGGGAAGGG - Intergenic
964291074 3:155180622-155180644 GAAAGGGTGTGGAGGGAGGAAGG + Exonic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964642999 3:158929786-158929808 GATTGGTTGTGGAGTGTGAGAGG + Intergenic
964643621 3:158935424-158935446 TATTGTGTGTGGAGTGGGAATGG + Intergenic
964863941 3:161232818-161232840 GAATGGGTGTTTGGGGAGAAGGG - Intronic
964917024 3:161851595-161851617 GAGTGAGTGAGGAAGGAGAATGG + Intergenic
965273340 3:166648044-166648066 GAAAGATTGTGGAGGGAGAAAGG - Intergenic
965327700 3:167328428-167328450 GATTGGAGGCGTAGGGAGAATGG - Intronic
965477686 3:169177464-169177486 GTTTGGGGGTGGAGGGCGAGGGG + Intronic
965754442 3:172011251-172011273 AATTTGCAGTGGAGGGAGAAAGG + Intergenic
966047634 3:175572023-175572045 GATTGTGTGTGGAGTGGGGATGG + Intronic
966332627 3:178831744-178831766 GCTTGAGTGTGGAGGGAGGAAGG + Intronic
966495889 3:180580330-180580352 TATGGGGTGGGGAGTGAGAATGG - Intergenic
966534541 3:181017012-181017034 GATTGGGCATAGTGGGAGAATGG - Intergenic
968124670 3:196149851-196149873 GAGTGGGTGTGCTAGGAGAATGG - Intergenic
969101926 4:4775811-4775833 GATGGGATGTGGAGGGAGAGGGG + Intergenic
969465047 4:7351340-7351362 GATGGGGAGAGGAGGGAGAAAGG - Intronic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970740756 4:19234963-19234985 GAATGTGTGTGAAGGGAGGAAGG - Intergenic
971019950 4:22524351-22524373 GAATGGGTGTGGTGAGAGAGAGG - Intergenic
971221016 4:24706059-24706081 GATTGCATGTGGAGGACGAAGGG + Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972315782 4:37924206-37924228 GATTGTTTGGGGAGGGAGCATGG - Intronic
972594140 4:40515521-40515543 GAGTGGGTGGGGACAGAGAATGG - Intronic
973269211 4:48244170-48244192 GATTGAGTGTGGGGAGAGGAAGG - Intronic
974345969 4:60681807-60681829 GATTAGTTGTCGAGGGAGTATGG + Intergenic
976715333 4:88117213-88117235 GCTTGGGTGAGGTGGGAGGATGG + Intronic
976744768 4:88391993-88392015 GAAGGGGAGGGGAGGGAGAAGGG - Intronic
977505242 4:97893813-97893835 GAATGGATGTTGAGGGAGACAGG + Intronic
977773170 4:100883489-100883511 GATTGGGTGGGAATAGAGAATGG - Intergenic
978113469 4:104991050-104991072 GGTTTGGGGTGGAGGGAGGATGG + Intergenic
978425681 4:108579829-108579851 GTTGGGGTGTGGGGGAAGAATGG + Intergenic
979120744 4:116897257-116897279 GCTTGGGGGTGGAGGGAGATGGG - Intergenic
979781656 4:124659100-124659122 GAAGGGGAGGGGAGGGAGAAAGG - Intergenic
980735854 4:136887181-136887203 GATTTGATGTGGGGTGAGAATGG - Intergenic
981566326 4:146105312-146105334 GGGTGGGTGTGGATGGAGACAGG - Intergenic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982213396 4:153059471-153059493 GACTTGGAGTGAAGGGAGAAGGG - Intergenic
982906418 4:161080327-161080349 TATTGGCTGTGGGGGGAGCAGGG + Intergenic
983812700 4:172082859-172082881 TATTGGAAGTGGAGGGAGAGGGG + Intronic
983905172 4:173174151-173174173 TATTATGTGTGGGGGGAGAAGGG - Intronic
985137477 4:186801746-186801768 GAGTGGGGGTGGTGGGAGAGAGG + Intergenic
985767767 5:1789091-1789113 GGTTGGCTGGTGAGGGAGAAGGG + Intergenic
986969495 5:13315559-13315581 GATTGGGTTTGGAGTGTGAATGG - Intergenic
987109069 5:14667901-14667923 TATTGGGGGTGGAGTGAGCAGGG - Intronic
987216900 5:15747056-15747078 GAATGAGTGTGGAGGGAAAAGGG + Intronic
988140522 5:27233212-27233234 GAGTGAGTGTGGAGGAGGAAAGG - Intergenic
988619781 5:32811348-32811370 GATGGGGAGTGCAGGGGGAAAGG - Intergenic
989056588 5:37371355-37371377 GATAGGGTGAGGAGGAAGGAGGG + Intergenic
990386578 5:55269835-55269857 GTTTGGGTGGGGAGGGAATAAGG + Intronic
991177515 5:63707074-63707096 GAGTGGGTGTGGGAAGAGAATGG - Intergenic
991506508 5:67329510-67329532 GATAGGGGATAGAGGGAGAAAGG - Intergenic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992039727 5:72817368-72817390 GCATGGGAGTGGAGGTAGAAGGG - Intronic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
992541336 5:77767666-77767688 GATTGTCTGTGGAGGGAGAAAGG - Intronic
992629163 5:78664262-78664284 GATAGGGTGTGAAAGGAAAATGG + Intronic
992657167 5:78922195-78922217 GATTTGGTGGGGGGGGAGGAGGG + Intronic
994353091 5:98769107-98769129 GATTGAGTGTGGTGGGGGGAAGG + Intronic
995740986 5:115355520-115355542 GAATTGGTGTGAAGGGAGAGAGG + Intergenic
996887434 5:128374353-128374375 GGATGGGGGTGGTGGGAGAATGG - Intronic
996923353 5:128794781-128794803 GGTTGGGGGTGGAGGGAGGGGGG - Intronic
997197413 5:131989203-131989225 GGTGGGGTGTGGATGGAGCATGG + Intronic
997850630 5:137329636-137329658 GATGTAGTGGGGAGGGAGAAGGG + Intronic
998226675 5:140332382-140332404 GATTGGCTGTGGAGCAAGATAGG + Intergenic
998360526 5:141582277-141582299 GATGGGGTTTGGAATGAGAATGG + Intronic
999116193 5:149165698-149165720 GAATGAGTGAGCAGGGAGAAAGG - Intronic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999827788 5:155290640-155290662 GGTTGGGGGTGGAGGGGAAATGG + Intergenic
1000250645 5:159491700-159491722 GATGAGGTGTGGATGGAGACTGG - Intergenic
1000305665 5:159992139-159992161 GGTTGGGGGTGGAGGGATGATGG + Intergenic
1001599659 5:172920632-172920654 GATTTGGTGTGGAGGGGGAGTGG + Intronic
1001748313 5:174108970-174108992 GATTGGAGGTTGGGGGAGAAGGG - Exonic
1002792249 6:445159-445181 GGCGTGGTGTGGAGGGAGAACGG + Intergenic
1002874960 6:1202555-1202577 GCTGGGGTGAGGAGGGAGAGCGG - Intergenic
1003129659 6:3385074-3385096 GCTGGGGAGAGGAGGGAGAATGG + Intronic
1003143289 6:3489412-3489434 TATGGGGTGGGGAGTGAGAATGG - Intergenic
1003571187 6:7257785-7257807 GCCTGGGTGTGGAGGCAGAGAGG - Intergenic
1003625557 6:7738286-7738308 GAGTGGGTGTGGGGGCAGAGAGG - Intronic
1003782120 6:9441163-9441185 AATGGGTTCTGGAGGGAGAAGGG + Intergenic
1004723512 6:18289682-18289704 CAATGGGTGTTGAGGTAGAATGG - Intergenic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005736526 6:28752919-28752941 TCTTGGGTGGGGTGGGAGAAGGG + Intergenic
1005838597 6:29725301-29725323 GATGGGGTAAGGAGGGAGATGGG + Exonic
1005859506 6:29889599-29889621 GATGGGGTAAGGAGGGAGATGGG + Intergenic
1005867070 6:29944392-29944414 GATGGGGTAAGGAGGGAGATGGG + Exonic
1005944229 6:30583987-30584009 GAAGGGATGTGGAGGGAGACTGG + Intronic
1006457956 6:34142805-34142827 GGTTGGGGGAGGAGGGAGGAGGG + Intronic
1006641337 6:35491260-35491282 GGTGGGGGGTGAAGGGAGAAGGG + Intronic
1006794010 6:36720974-36720996 GATTGGATGAGGAGGAGGAATGG + Intronic
1006833511 6:36983341-36983363 GATTTGGAGTGGAGGAATAAAGG - Intronic
1007605841 6:43117417-43117439 GATTGGTTGTGGAGGGAATGTGG + Intronic
1007690037 6:43694997-43695019 GACAAGGTGTGGAGGAAGAAGGG - Intergenic
1008232579 6:49001765-49001787 TAATGGGTGAGGAGGAAGAAGGG - Intergenic
1008723473 6:54387533-54387555 GATGGGGAGTGGAGGGTGGATGG + Intronic
1010186907 6:73155503-73155525 AATTTGGTGTGGCTGGAGAATGG + Intronic
1010477310 6:76303882-76303904 ACTTGAGTGTGGAGGGAGGAGGG - Intergenic
1011406230 6:87018168-87018190 GTTGGGATGGGGAGGGAGAAAGG - Intergenic
1012442034 6:99269996-99270018 GAATGGGTTTGCAGGGAAAATGG - Intergenic
1012545707 6:100417092-100417114 GATTGGGTCTGGAGGTGGAGTGG - Intronic
1012837696 6:104291295-104291317 AAGTGGGTGTGGAGGCAGACAGG - Intergenic
1013032832 6:106352357-106352379 GAGAGGGTGTTGGGGGAGAAAGG - Intergenic
1013291136 6:108719681-108719703 GCCTGGGAGTGCAGGGAGAACGG + Intergenic
1013451489 6:110286150-110286172 GACTGGGTGGGGAGAGAGAGGGG + Intronic
1014549890 6:122778504-122778526 AATTGGGAGGGGAGAGAGAAGGG + Intergenic
1015764235 6:136699203-136699225 GATAGGATGTGGAAGGGGAAGGG - Intronic
1016988657 6:149913601-149913623 GATTTGCTGTGGAGAGAGAAGGG - Intergenic
1016994316 6:149951049-149951071 GATTTGCTATGGAGGGAGACAGG + Intergenic
1017007970 6:150041495-150041517 GATTTGCTGTGGATGGAGACAGG - Intergenic
1017180185 6:151544796-151544818 GTTTGGGGGTGGCAGGAGAATGG + Intronic
1017455474 6:154597486-154597508 GGATGGGTGTGGACAGAGAAGGG - Intergenic
1017511947 6:155122337-155122359 GATTGGGAGGGAATGGAGAATGG + Intronic
1017511988 6:155122493-155122515 GATTGGGAGGGAATGGAGAATGG + Intronic
1018099051 6:160420336-160420358 GTTTGGGTGAGTAGGGGGAAAGG - Intronic
1018677514 6:166235858-166235880 GGGTGGCTGTGGAAGGAGAACGG + Intergenic
1018717585 6:166545595-166545617 GACGGGGTGGGGAGGCAGAAAGG - Intronic
1018787444 6:167119121-167119143 GCCTGGGTGGGGAGGCAGAAAGG - Intergenic
1018844679 6:167547393-167547415 GATGGGGTGAGGAGGGAGGAGGG - Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018998161 6:168725871-168725893 GCTTTGGGGTGGAGGGAGACTGG - Intergenic
1019031948 6:169021138-169021160 GAGTGGGGGTGCAGTGAGAAGGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019935264 7:4250946-4250968 GCCAGGGTTTGGAGGGAGAAGGG - Intronic
1020687098 7:11309569-11309591 GCTTGGGGGTGGAGGGACAGAGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1022105851 7:27197619-27197641 TATTTGCTGTGAAGGGAGAAAGG - Exonic
1022310787 7:29194437-29194459 GAGTTGGGGCGGAGGGAGAAGGG + Exonic
1022921384 7:35018952-35018974 GATTGGGGGTGGAAGAAAAAAGG + Intronic
1023180717 7:37480663-37480685 GAGTGGGGGTGGAAGGAGACTGG + Intergenic
1023183985 7:37514490-37514512 GATGGGGTGAGGAGGGTGTAAGG + Intergenic
1023775282 7:43599848-43599870 GAGTGGGAGTGTAGGGAGCAGGG + Intronic
1023898569 7:44455506-44455528 GATTGGGCTTGGAGGGAAAGAGG - Intronic
1023926718 7:44674908-44674930 GAAGGTGTGGGGAGGGAGAAGGG + Intronic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024217157 7:47257118-47257140 TACAGGGTGTGGAGGAAGAAGGG + Intergenic
1024305795 7:47928651-47928673 GATTGGGGGTGGAGGGTGAGTGG - Intronic
1024585194 7:50836005-50836027 GAGTGTATGTGGAGGGAGAAAGG - Intergenic
1025198777 7:56949647-56949669 GAAGGGGAGAGGAGGGAGAAGGG - Intergenic
1025673169 7:63627286-63627308 GAAGGGGAGAGGAGGGAGAAGGG + Intergenic
1027054344 7:75039726-75039748 GAGTTGGTGTGTATGGAGAATGG + Intronic
1027481445 7:78702700-78702722 GATTAGATTTGGAGGTAGAAAGG + Intronic
1027868642 7:83678243-83678265 GGTTGGTTGAGGATGGAGAAGGG - Intergenic
1028297890 7:89158372-89158394 GAATGGGTGTGGAGGGCTAAGGG - Intronic
1028320409 7:89452437-89452459 GATGGAGTGTGGAGGGGGGAGGG + Intergenic
1028333259 7:89622630-89622652 GACTGGGTGTGGAGTGGAAAGGG - Intergenic
1028713790 7:93940869-93940891 GATTTGCTGTTGAGGGAGAGAGG - Intergenic
1029593656 7:101524902-101524924 GGTTGGATGTGGAGGCAGAGAGG + Intronic
1029696653 7:102217950-102217972 GATGGTGTCTAGAGGGAGAAAGG + Intronic
1030501922 7:110370053-110370075 GATGGGTTGTGGAGGCAAAATGG - Intergenic
1030509588 7:110468320-110468342 GATTGGGACTAGAGGGAGAAGGG - Intergenic
1031107198 7:117559172-117559194 GAATAGGTTTGGAGGAAGAATGG - Intronic
1031508499 7:122618490-122618512 AATAGGGTATGGTGGGAGAAGGG + Intronic
1031900158 7:127400040-127400062 AACTGGGTGGGGAGGGAGTATGG + Intronic
1032069858 7:128797645-128797667 GATTGGGTTTGGAGAGGAAATGG + Intronic
1032269372 7:130389538-130389560 GATTGGGGCTGGAGTGAGGATGG + Intergenic
1032338160 7:131045448-131045470 GCTTGGGAGAGGAGGGAGAAAGG - Intergenic
1032879239 7:136071504-136071526 GAATGGAAGTTGAGGGAGAATGG + Intergenic
1033676817 7:143549616-143549638 GAGAGTGGGTGGAGGGAGAAAGG - Intergenic
1034612330 7:152382453-152382475 CATTGGGTGGGGTGGGGGAAGGG - Intronic
1034937288 7:155208412-155208434 GAATGGGTGTGTGGGGGGAATGG + Intergenic
1035245655 7:157560717-157560739 AATTGGGTGAGGTGGGAGGAGGG - Intronic
1035530349 8:346034-346056 AATGGGATGTGGAGGGATAAAGG - Intergenic
1036394071 8:8351831-8351853 GAGATGGTGTGAAGGGAGAAAGG - Intronic
1036766503 8:11552745-11552767 AATCTGGTGTGGAGGAAGAAGGG + Intronic
1036928105 8:12927251-12927273 GATGGGGTTTGGAGGAAGAAGGG - Intergenic
1037447453 8:18980656-18980678 GAGCGTGTGTGGAGGGAGAGAGG - Intronic
1037659520 8:20914983-20915005 GTTTGTGTGTGGAGAGAGGAGGG - Intergenic
1037757353 8:21719756-21719778 GGAAGGGTGGGGAGGGAGAAAGG - Intronic
1038311587 8:26449584-26449606 GACTGGGTGTGGAGAGAAAACGG + Intronic
1038770272 8:30472387-30472409 GATTGCCTGGGGATGGAGAATGG + Intronic
1039339607 8:36632915-36632937 GATTGGGAATGGAGTCAGAAAGG + Intergenic
1040629046 8:49188075-49188097 GGTTGGGTGTGGTGGGAGCCAGG + Intergenic
1040772748 8:50998807-50998829 GCTTGGATGAGTAGGGAGAAGGG + Intergenic
1041806873 8:61861019-61861041 TTTTGAGTGTGGAGAGAGAAGGG - Intergenic
1041960585 8:63610953-63610975 GAATGGGTGTGGAGGAATAGAGG + Intergenic
1043878230 8:85510665-85510687 AATTGGGTGTGCAGGGAGGAAGG - Intergenic
1044587742 8:93883820-93883842 GAGTGGATGTGGAGGCAGCAAGG - Intronic
1045244431 8:100430638-100430660 GATTTGGTGGGGAGGAAGAAAGG - Intergenic
1045252887 8:100496122-100496144 GAAAGGGAGTGGAAGGAGAAGGG + Intergenic
1045710339 8:104975648-104975670 GAGTGGGGGAGGAGAGAGAAAGG - Intronic
1046393540 8:113609363-113609385 GATTGGGAGAGAAGGTAGAATGG - Intronic
1046437581 8:114212228-114212250 GAATGGGGGTGGAGGGAAAGAGG + Intergenic
1046447287 8:114339423-114339445 GATTAAATGTCGAGGGAGAATGG + Intergenic
1046494766 8:114998980-114999002 GATAGGGAGGGGAGGGAGAAAGG - Intergenic
1047314781 8:123722862-123722884 GATTGGGTGTGAAATGAGGAGGG - Intronic
1047965273 8:130041809-130041831 GATGGAGTGTGGAGGGAACAAGG + Intergenic
1048155464 8:131944066-131944088 GAATAGGTGAGAAGGGAGAAAGG - Intronic
1048407139 8:134135318-134135340 GAGTGGGCTTGGAGGAAGAAAGG - Intergenic
1049386058 8:142343744-142343766 GATGGGGAGTGGGGGGAGGAGGG + Intronic
1049712357 8:144071158-144071180 GAGGGGGAGGGGAGGGAGAAAGG - Intergenic
1050260692 9:3837982-3838004 GATTGTGTGTGGAGGGGGTGGGG + Intronic
1050377707 9:4990121-4990143 GATTGGATAAGAAGGGAGAATGG + Intronic
1050648780 9:7752690-7752712 GATAGGGGGAGGAGGGAGCAGGG + Intergenic
1051038445 9:12776731-12776753 GATTGAGACTTGAGGGAGAAGGG - Intronic
1051059159 9:13026353-13026375 GCTAGAGTGGGGAGGGAGAAGGG + Intergenic
1051105015 9:13569515-13569537 GGCTGGGGCTGGAGGGAGAAAGG - Intergenic
1051982911 9:23045995-23046017 GATTGAGTTTGGTGGGGGAAGGG + Intergenic
1052049592 9:23830226-23830248 GCTAGGGGGTGGAGGGAGCAGGG - Intergenic
1052864788 9:33458350-33458372 GGTGGAGTGTGGAGGAAGAAAGG - Intergenic
1052879732 9:33594105-33594127 GGTTGGGGGTGGAAGGAGAAAGG + Intergenic
1053188491 9:36038497-36038519 GACTGGTTGTGGGAGGAGAATGG - Intronic
1053496249 9:38550124-38550146 AGTTGGGGGTGGAAGGAGAAAGG - Intronic
1053662744 9:40295848-40295870 GGGTGGGTGTGGATGGAAAAAGG + Intronic
1053913190 9:42926023-42926045 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054374874 9:64442072-64442094 GGGTGGGTGTGGATGGAAAAAGG + Intergenic
1054521869 9:66080436-66080458 GGGTGGGTGTGGATGGAAAAAGG - Intergenic
1055292950 9:74802836-74802858 GATTATGTGAGGAGGTAGAATGG - Intronic
1055402805 9:75942348-75942370 GGTTGGCTGTGTTGGGAGAAAGG + Intronic
1055624703 9:78164070-78164092 GATTGGATGTGGAGGACAAAGGG + Intergenic
1056138887 9:83655356-83655378 GGTTGGGTGAGGAGGGAATAGGG + Intergenic
1056677281 9:88686291-88686313 GGGTAGGTGTGGAGGGAGAGGGG - Intergenic
1057045771 9:91885324-91885346 GGCAGGGTGTGGAGGGAGATGGG + Intronic
1057480349 9:95440496-95440518 GAAGGGGGGAGGAGGGAGAAGGG + Intergenic
1057676173 9:97137663-97137685 GGTTGGGGGTGGAAGGAAAAAGG - Intergenic
1057763225 9:97892875-97892897 CATGGGGTGCTGAGGGAGAAAGG - Intergenic
1057938949 9:99263834-99263856 GATTAGGTGTTGATGGAAAAGGG - Intergenic
1058846094 9:108960848-108960870 GTTTGGGTGAGAAGGCAGAATGG + Intronic
1059451433 9:114373369-114373391 GAGGTGGTGGGGAGGGAGAAAGG + Intronic
1059514451 9:114880028-114880050 GAGTGGTTTTGTAGGGAGAAAGG + Intergenic
1059669336 9:116478109-116478131 GAGGGGGTAGGGAGGGAGAAAGG + Intronic
1060018418 9:120107377-120107399 GTTTGGGAATGCAGGGAGAAAGG + Intergenic
1060033438 9:120234963-120234985 GATCGAGGGAGGAGGGAGAAAGG - Intergenic
1060180470 9:121530101-121530123 GACTGGGGGAGAAGGGAGAATGG + Intergenic
1060223581 9:121776895-121776917 GTTTGAGTGGGGAGGGAGAGGGG + Intronic
1060443418 9:123663624-123663646 GATTGGGGTTGGAGGGAGAGTGG + Intronic
1060473244 9:123965992-123966014 GATTGGGTGGGGCAGAAGAAGGG - Intergenic
1060555781 9:124506620-124506642 GATTGGAGATAGAGGGAGAAGGG - Intronic
1060859747 9:126944577-126944599 AATTGGGTGGGGAGGGAGGGTGG + Intronic
1060871741 9:127048152-127048174 GATTGGGTGTGTGGTGAGGAGGG - Intronic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061663058 9:132143298-132143320 GGTTGGGTGGGGTGGGAGAAAGG - Intergenic
1061886969 9:133596053-133596075 GGGTGGGTGTGGAGGCAGAGTGG + Intergenic
1062005883 9:134238171-134238193 GATGGGGTTTGGAAGGAGATGGG + Intergenic
1062640431 9:137515767-137515789 GATGGGGTGGGGAGGGAGATTGG - Intronic
1186796943 X:13056268-13056290 GTTAGGGTCTGGAGAGAGAAGGG - Intergenic
1187746297 X:22412957-22412979 GCTAGGGAGTGAAGGGAGAAGGG - Intergenic
1187884138 X:23873180-23873202 TATTGGGGGTGGAGTGAGGATGG - Intronic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1189097393 X:38154988-38155010 GATTGGGTGTGGAGGGCATAGGG - Intronic
1189852639 X:45192584-45192606 GGTTGGGTATGGAGGTAGAGTGG - Intronic
1191906507 X:66096917-66096939 GTTTGGGGGTGGAGGGTGAGGGG + Intergenic
1192158976 X:68768840-68768862 GATTGGGTGTGGAGGTGGGTTGG - Intergenic
1192365760 X:70471693-70471715 GATTGGATGTAGAGTGAGAAAGG - Intronic
1192615125 X:72612330-72612352 GATTGGGGGTTGATGGATAAAGG + Intronic
1192940960 X:75911459-75911481 GATTTGTTTTGGAGGGAGGAAGG + Intergenic
1193084635 X:77438204-77438226 GAAAGGGTGTGTGGGGAGAAGGG + Intergenic
1194878872 X:99225337-99225359 CCTTGAGGGTGGAGGGAGAAAGG - Intergenic
1195090509 X:101454136-101454158 GATGGGGTGGGGAAGGAGCAGGG + Intronic
1195107801 X:101617380-101617402 GAGTGGGTGTGGAGAAAGAAGGG + Intronic
1195369538 X:104159288-104159310 GATATGGTGTGTAGGGTGAAAGG - Intergenic
1195732430 X:107980763-107980785 GATTGGGTGGAGTGGGGGAAAGG - Intergenic
1196179968 X:112679119-112679141 GAGTGGTTGTGGGGAGAGAAAGG - Intronic
1197861376 X:130974451-130974473 GATTGTGTCTGGGTGGAGAAAGG + Intergenic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1199496801 X:148461167-148461189 GTTTGGATGTGGAGTGTGAAAGG - Intergenic
1200067605 X:153511557-153511579 GATTGGGTGTAGTGTGAGAACGG + Intergenic