ID: 1064288705

View in Genome Browser
Species Human (GRCh38)
Location 10:14014140-14014162
Sequence CACCCGAACCTGCCCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064288702_1064288705 -9 Left 1064288702 10:14014126-14014148 CCCACTGCAGCCATCACCCGAAC 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG No data
1064288700_1064288705 0 Left 1064288700 10:14014117-14014139 CCCATGGTTCCCACTGCAGCCAT 0: 1
1: 0
2: 1
3: 32
4: 249
Right 1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG No data
1064288703_1064288705 -10 Left 1064288703 10:14014127-14014149 CCACTGCAGCCATCACCCGAACC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG No data
1064288701_1064288705 -1 Left 1064288701 10:14014118-14014140 CCATGGTTCCCACTGCAGCCATC 0: 1
1: 0
2: 2
3: 46
4: 338
Right 1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064288705 Original CRISPR CACCCGAACCTGCCCCCAGC TGG Intronic
No off target data available for this crispr