ID: 1064294146

View in Genome Browser
Species Human (GRCh38)
Location 10:14062855-14062877
Sequence CAGTGAAAGGGGAAGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064294140_1064294146 20 Left 1064294140 10:14062812-14062834 CCAGCACTTTGGGAGGTTGCAGT 0: 3
1: 139
2: 3358
3: 43174
4: 149502
Right 1064294146 10:14062855-14062877 CAGTGAAAGGGGAAGATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064294146 Original CRISPR CAGTGAAAGGGGAAGATACA TGG Intronic
No off target data available for this crispr