ID: 1064294146 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:14062855-14062877 |
| Sequence | CAGTGAAAGGGGAAGATACA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064294140_1064294146 | 20 | Left | 1064294140 | 10:14062812-14062834 | CCAGCACTTTGGGAGGTTGCAGT | 0: 3 1: 139 2: 3358 3: 43174 4: 149502 |
||
| Right | 1064294146 | 10:14062855-14062877 | CAGTGAAAGGGGAAGATACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064294146 | Original CRISPR | CAGTGAAAGGGGAAGATACA TGG | Intronic | ||
| No off target data available for this crispr | |||||