ID: 1064296158

View in Genome Browser
Species Human (GRCh38)
Location 10:14080611-14080633
Sequence CTGTGATTGTAGCTGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064296158_1064296162 26 Left 1064296158 10:14080611-14080633 CCTGGACACAGCTACAATCACAG 0: 1
1: 0
2: 0
3: 18
4: 195
Right 1064296162 10:14080660-14080682 GCCCTACCATTTTGCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064296158 Original CRISPR CTGTGATTGTAGCTGTGTCC AGG (reversed) Intronic
904113908 1:28147954-28147976 CTGGGATGGTAGCTGTGGGCTGG - Exonic
904836424 1:33340468-33340490 CTGTGTTTGCTGCTGTCTCCTGG - Intronic
905251599 1:36652482-36652504 TTGTAATTGTAACTTTGTCCTGG - Intergenic
905884879 1:41486301-41486323 CTGTGATAATAGCTGCCTCCTGG - Intergenic
911244930 1:95506532-95506554 CTGTGTTTGTTCCTATGTCCAGG + Intergenic
912194508 1:107381749-107381771 GTCTGAATCTAGCTGTGTCCTGG - Intronic
916058804 1:161085309-161085331 CTGTGCTGGGAGCTGTGTCTGGG - Intronic
917848912 1:179043352-179043374 CTGTGGGTGTAGCTGTGGCTGGG + Intronic
918138227 1:181696623-181696645 CTGTAAGTGGAGCTGTGACCAGG + Intronic
919205719 1:194420230-194420252 CTGTGAGTCTGGCTGAGTCCTGG + Intergenic
920445043 1:206010071-206010093 CAGAGAATGTAGCTGTTTCCAGG - Exonic
924291477 1:242541156-242541178 CTTTGCTGATAGCTGTGTCCAGG - Intergenic
1062886485 10:1020569-1020591 CTGTGAATGTAGCTGTGGATGGG - Intronic
1063265738 10:4448428-4448450 CTGTGATTGCTCCTATGTCCAGG - Intergenic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1064358903 10:14645536-14645558 CTGTGATTGTAACTGAGCACAGG + Intronic
1064402915 10:15036146-15036168 CTGTGGTTATAGCTATTTCCTGG + Intronic
1067304571 10:45049503-45049525 TTGTGACTGTACCTATGTCCTGG + Intergenic
1069099765 10:64305723-64305745 CAGTTAATGTAGCTGAGTCCAGG + Intergenic
1070245817 10:74730468-74730490 CTGTGATGGGAGGAGTGTCCTGG - Intergenic
1070902102 10:80038764-80038786 CTGTTATGGTACCTGTGACCTGG - Intergenic
1071166768 10:82816465-82816487 CTGTGAGTCCAGCTGAGTCCAGG + Intronic
1071246659 10:83772658-83772680 CTGTGAATGTGACTGGGTCCTGG + Intergenic
1072621463 10:97082164-97082186 CTGTGCTTGCATCTGTGTTCAGG - Intronic
1075132071 10:119748664-119748686 CTGTGAGTCTGGCTGAGTCCGGG + Intronic
1075785249 10:125045071-125045093 CAGTGATTGTATCTGGGTGCTGG + Intronic
1077884414 11:6375681-6375703 CTGTAATGATAGCTGTGTCTTGG - Intergenic
1079963130 11:26948489-26948511 CTCTGAGTCTAGCTCTGTCCTGG - Intergenic
1080197002 11:29623114-29623136 CTGTAATTATAGCTGAGTCTTGG + Intergenic
1082814364 11:57498601-57498623 CTGTGACCATGGCTGTGTCCCGG + Intronic
1084690103 11:70720144-70720166 CTGGGGGTGCAGCTGTGTCCAGG - Intronic
1086037477 11:82434201-82434223 CTGTTATTATAGCTGTCTGCCGG - Intergenic
1087591611 11:100196174-100196196 CTATGATTGGAGCACTGTCCAGG + Intronic
1094742343 12:33303849-33303871 CTGTGATTGTACTAGTGTACAGG - Intergenic
1097446471 12:59678572-59678594 CTTTGAGTCTAGCTGAGTCCAGG + Intronic
1099033749 12:77560209-77560231 CTGTGAGTCTGGCTGAGTCCAGG - Intergenic
1099892066 12:88602002-88602024 CCCTGATTGTAGCTCTGTCCGGG - Intergenic
1100016213 12:90013869-90013891 CTGTGATGTCAGCCGTGTCCAGG + Intergenic
1100340927 12:93678747-93678769 CTGTGATTTTGGCTCTTTCCAGG + Exonic
1101758058 12:107636803-107636825 CAGAGATTGTTGCTATGTCCTGG - Intronic
1102977196 12:117215189-117215211 CTGTCCTTGTCGCTGTGCCCTGG - Exonic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1103609738 12:122115782-122115804 CTGGGATTACAGCTGTGCCCAGG - Intronic
1104541032 12:129664843-129664865 CTGTCATTGTTTTTGTGTCCAGG - Intronic
1104589609 12:130073920-130073942 ATTTGAATGTAGGTGTGTCCTGG + Intergenic
1105611750 13:21974864-21974886 CTGTGAATGGAGCTGTCTCAGGG + Intergenic
1107073713 13:36298657-36298679 CTTTGAATCTAGCTGTGACCTGG - Intergenic
1109971033 13:69769672-69769694 CTGTGTGTGTGGCTGAGTCCTGG - Intronic
1116718474 14:48460056-48460078 CTGTGAGTGTAGCTGTGAGCTGG - Intergenic
1119055510 14:71415517-71415539 CTGTGAATGTAGCTCTGCTCTGG + Intronic
1120893622 14:89510511-89510533 GTGTGATCGGAGCTGTGTGCTGG - Intronic
1122842296 14:104472359-104472381 CTGTGTGTGTGGCTGTGTGCAGG - Intergenic
1123625411 15:22223636-22223658 GTGTGTGTGTAGCTGTCTCCTGG - Intergenic
1123625459 15:22223973-22223995 GTGTGTGTGTAGCTGTCTCCTGG - Intergenic
1124836974 15:33204755-33204777 CTGTGATTGAGGGTGTGTGCAGG + Intergenic
1127140156 15:55967750-55967772 CTGTGATAATAGGTGTGTGCCGG - Intronic
1128525072 15:68406899-68406921 GTGTGATTGTATCTGTCTCATGG - Intronic
1129178080 15:73854397-73854419 GTGTGGGTGTAGCTGTGTGCTGG - Intergenic
1130107498 15:80940008-80940030 AAGTGATTGTAGCTGTGTTCTGG + Intronic
1130398628 15:83529084-83529106 CTGTGATTGTCTCAGTGGCCTGG + Intronic
1131059802 15:89397639-89397661 AAGTGATTGTAGCTGTGCCCAGG - Intergenic
1131999221 15:98162847-98162869 CTGTGAGTCTGGCTGAGTCCAGG + Intergenic
1133344216 16:5059531-5059553 CCGTGAATCCAGCTGTGTCCTGG + Intronic
1133446653 16:5866874-5866896 CTGTCATTGTAGCTTTTACCTGG + Intergenic
1134006701 16:10822791-10822813 CTGTGTGTGTACCTCTGTCCAGG - Intergenic
1137645665 16:50071095-50071117 CTGTGATTGTAGCAGTGGTGAGG + Intronic
1138298349 16:55906226-55906248 CTGAGATTGTCCCTGTTTCCTGG + Intronic
1138730087 16:59184842-59184864 CTCTGGTTGTGGCTGTCTCCTGG + Intergenic
1139121493 16:64023827-64023849 CTGAGAGTGTAGGTGTATCCTGG + Intergenic
1140605139 16:76527034-76527056 CAGTGATTAAAGCTGTTTCCTGG + Intronic
1141024754 16:80535471-80535493 CTGTAATTGTATCTGTGTCGAGG + Intergenic
1141427344 16:83952881-83952903 CTGTTATTTTAACTGTGTGCGGG + Intronic
1143092846 17:4459215-4459237 CTGTGAGTTTAGCAGGGTCCAGG + Intronic
1143251306 17:5525245-5525267 CTGTGGATGTAGCTGTGAACAGG + Intronic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1150185581 17:63177712-63177734 CTGTGATTGTTTCTGGGTTCAGG + Intronic
1150201502 17:63362245-63362267 CTGTGAGTTTGGCTGAGTCCAGG + Intronic
1150225063 17:63520077-63520099 ATGTGATTCTATGTGTGTCCTGG + Intronic
1150620673 17:66805828-66805850 CTGTGACTGTTGCTGACTCCAGG + Exonic
1154087649 18:11322910-11322932 CTGTGGTTCTGGCTGGGTCCTGG - Intergenic
1155391637 18:25343987-25344009 CAGTGCTTGTAGCTGTGGCAGGG + Intronic
1160116600 18:76084858-76084880 CTGTGAGTCTGGCTGTGTCCAGG + Intergenic
1160287213 18:77554873-77554895 CTGTGATTGTATCAGTGCCTTGG - Intergenic
1160322288 18:77906900-77906922 CTGAGATTGCAGCGCTGTCCGGG + Intergenic
1162536456 19:11265343-11265365 CCTTGAGTGGAGCTGTGTCCTGG - Intergenic
1165849677 19:38842505-38842527 CTGTGCTTGTAGCTGTTCCTTGG + Intronic
1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG + Intronic
1167538099 19:50068294-50068316 CCTGGATTGTAACTGTGTCCAGG - Intergenic
1168499046 19:56878048-56878070 CTGTGTGTGTGTCTGTGTCCTGG + Intergenic
1202632989 1_KI270706v1_random:17055-17077 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1202652886 1_KI270707v1_random:22995-23017 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1202659265 1_KI270708v1_random:52749-52771 CTGTAACTATAGCTGAGTCCTGG - Intergenic
930681559 2:54262187-54262209 TTGTGACTGGACCTGTGTCCTGG + Intronic
933237012 2:79875127-79875149 CTGTTTCTGTAGGTGTGTCCTGG + Intronic
933724433 2:85418591-85418613 CTGTGTGTGTAAGTGTGTCCGGG - Intergenic
933773393 2:85757515-85757537 CTGGGATTGTGGCTCTGGCCTGG + Intronic
935341427 2:102063098-102063120 CAGAGATTCTAGGTGTGTCCAGG + Intergenic
936528290 2:113257305-113257327 TTGTTATTGTTGCTGTGTGCTGG + Intronic
937667403 2:124502522-124502544 CTTTGAATGCAGCTGTGTTCTGG + Intronic
938069340 2:128300283-128300305 TAGGGATGGTAGCTGTGTCCTGG - Intronic
939103264 2:137920424-137920446 CTGTGTTTGTTGCAGGGTCCAGG - Intergenic
939144591 2:138396906-138396928 CTGTGAATGTACCTGGGGCCTGG + Intergenic
939693554 2:145295791-145295813 CTGTGTGTATAGCTGTTTCCTGG + Intergenic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
944168465 2:196748930-196748952 CTGTGAATGTAGCAAAGTCCAGG - Intronic
945673275 2:212827561-212827583 TTTTGATAGTACCTGTGTCCAGG + Intergenic
946319544 2:218943859-218943881 CTGTGTCTGTTTCTGTGTCCAGG - Intergenic
947698110 2:232209846-232209868 CTGTGATTTGTGCTGTTTCCAGG + Intronic
1173029117 20:39338430-39338452 CTGTCATTGAACTTGTGTCCTGG - Intergenic
1173765244 20:45601380-45601402 AACTGATTGTACCTGTGTCCTGG + Intergenic
1173881097 20:46412798-46412820 CTTCAATTGTAGCTGAGTCCTGG + Intronic
1174225493 20:48995861-48995883 GTGTGGTTGTAGCTGTGGACAGG + Exonic
1174253607 20:49237698-49237720 CTGGCATTGGAGCTGAGTCCTGG + Intronic
1174972375 20:55290475-55290497 CTGGGATTATAGGTGTGGCCCGG + Intergenic
1175063770 20:56267766-56267788 TTGTGATTGTAGCTGATGCCTGG - Intergenic
1175530511 20:59671685-59671707 CTGTGATATTGGCTGTCTCCGGG + Intronic
1176599266 21:8776656-8776678 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1176645209 21:9342935-9342957 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1180326727 22:11436274-11436296 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1180367742 22:11956299-11956321 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1180419162 22:12798244-12798266 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1182145791 22:27996007-27996029 CCGTGATTGGGGCCGTGTCCAGG - Intronic
1184073330 22:42160583-42160605 CTGAGGTCATAGCTGTGTCCTGG - Exonic
1184413770 22:44340411-44340433 CTGGCTTTGTGGCTGTGTCCTGG + Intergenic
949325182 3:2855644-2855666 CTGTGATCTGACCTGTGTCCAGG + Intronic
952342343 3:32456842-32456864 CTAGGGTTGAAGCTGTGTCCAGG - Intronic
953438902 3:42901192-42901214 CTATGATTTTATCTGTGACCCGG - Intronic
957614531 3:82509745-82509767 CTGTGAGTCTGGCTGAGTCCAGG - Intergenic
958019311 3:87978683-87978705 CTGTGAGTCTGGCTGAGTCCAGG + Intergenic
958076656 3:88690064-88690086 CTGGGATGGAAGCTGAGTCCAGG + Intergenic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
963423030 3:145086632-145086654 CTGGGAGTGTAGCATTGTCCAGG - Intergenic
964927940 3:161979439-161979461 AGGTGGTTGCAGCTGTGTCCAGG + Intergenic
965206136 3:165720703-165720725 CTGTGAGTGTAGCTGATTCCAGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
1202741681 3_GL000221v1_random:62133-62155 CTGTAACTATAGCTGAGTCCTGG + Intergenic
968381974 4:104194-104216 CTGGGTTTGGAGCTGTCTCCAGG + Intergenic
969907840 4:10413881-10413903 TTCTGATTGTAGTTGAGTCCTGG + Intergenic
970294509 4:14614180-14614202 CTGTGATTGAAGGTCAGTCCTGG + Intergenic
972256481 4:37361204-37361226 CTGTGAATGTATCTGGTTCCGGG - Intronic
972788202 4:42346611-42346633 CTGTGAGTGCGGCTGTGTCTGGG - Intergenic
973362629 4:49179029-49179051 CTGTAACTATAGCTGAGTCCTGG - Intergenic
973398474 4:49617824-49617846 CTGTAACTATAGCTGAGTCCTGG + Intergenic
973581997 4:52353024-52353046 CTATAATTGTATCTCTGTCCTGG + Intergenic
973840587 4:54856320-54856342 CTGTGGTTGTGTCTGTGTGCAGG - Intergenic
974677057 4:65105365-65105387 TTGTTGTTGTTGCTGTGTCCTGG - Intergenic
976608151 4:87001896-87001918 AAGTGATTTTAGCAGTGTCCTGG + Intronic
978149466 4:105415607-105415629 GTGTGGCTGCAGCTGTGTCCAGG + Intronic
979927188 4:126582577-126582599 CTATCATTGTAGCTGGGTTCTGG - Intergenic
980730928 4:136823776-136823798 CTGTGAGTCTGGCTGTGTCCGGG + Intergenic
981104563 4:140865723-140865745 CTGTAAGTGCAGCTGTGGCCAGG + Exonic
981956826 4:150485558-150485580 CTGTGTATGTCTCTGTGTCCAGG - Intronic
983786192 4:171732636-171732658 CTTTGAATGTAGCTATGACCTGG - Intergenic
989040812 5:37226292-37226314 AAGTGATTATACCTGTGTCCTGG + Exonic
990130482 5:52576114-52576136 CTGTGAATGAAGTTGTGTACAGG + Intergenic
991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG + Intergenic
995259769 5:110089653-110089675 GTGTGATTGTATGTGTGTCTAGG + Intergenic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996458158 5:123708875-123708897 GTGTGATTATAGCTGTGTTCTGG + Intergenic
998788344 5:145737576-145737598 CTGTGCTTGTTGCTGTTTTCAGG - Intronic
999101469 5:149029109-149029131 CTGTGCTGGGAGTTGTGTCCTGG - Intronic
1000123490 5:158220639-158220661 CTGAGACTGTGGCTGTTTCCCGG - Intergenic
1000309922 5:160032613-160032635 CTGTCATTGCAGCCCTGTCCTGG + Intronic
1001699149 5:173694242-173694264 CTGTGATTGTCTCTGTAACCAGG + Intergenic
1003036501 6:2644837-2644859 CTCAGATAGTAGCTTTGTCCGGG - Intergenic
1003517139 6:6826733-6826755 CTCTGTTTGTAGCTCTGTGCTGG + Intergenic
1005423937 6:25681529-25681551 CTTTGAAGGTAGCTGTGGCCAGG + Intronic
1005811254 6:29518139-29518161 CTGTGAGTGTCTCTGTGTGCAGG + Intergenic
1006638555 6:35476796-35476818 GTGTGCTTGTAGCTGTGTATTGG + Intronic
1008231616 6:48990282-48990304 CTGTGAATCTGGCTGAGTCCAGG - Intergenic
1011113776 6:83867277-83867299 CTGTGTTTGTACCTTTGTTCAGG - Intronic
1011748695 6:90433875-90433897 CTGTTAGTGTGGCTGAGTCCAGG - Intergenic
1012627086 6:101417568-101417590 CTGTGATTATATCTGTGTGCAGG - Intronic
1016351688 6:143176144-143176166 CTGTGATGTTATCTGTCTCCAGG + Intronic
1016622857 6:146132797-146132819 GAATGATTGTAGCTGTGTACAGG - Intronic
1019572969 7:1721890-1721912 CAGTGATTGTATCTGTGCCATGG + Intronic
1019955033 7:4406578-4406600 CTGTGATTGAAGCTCTGTTTGGG - Intergenic
1021237997 7:18166813-18166835 ATTTGTTTGTAGCTTTGTCCTGG - Intronic
1021343118 7:19488976-19488998 CTGTGGGTCTAGCTGAGTCCGGG + Intergenic
1022982137 7:35613964-35613986 TTGAGTTTTTAGCTGTGTCCTGG - Intergenic
1023602808 7:41896887-41896909 CTGGGCTTTTAGCTGTCTCCTGG + Intergenic
1024223032 7:47303162-47303184 CTGTGGTGGCTGCTGTGTCCAGG + Exonic
1029949978 7:104573597-104573619 GTGTGAATGTAGCTGTGAACAGG - Intronic
1030328992 7:108252997-108253019 CTGTCATTTTAGATATGTCCTGG - Intronic
1032270133 7:130397661-130397683 CTGTGATCGTAGCTGTGATAAGG - Exonic
1033345783 7:140524848-140524870 CTGGGATTGTAAGTGTGCCCCGG + Intronic
1035231755 7:157469727-157469749 CTCAGGTTGAAGCTGTGTCCAGG + Intergenic
1036029635 8:4954387-4954409 TTCTGATTGAAGCTGTTTCCAGG + Intronic
1036682224 8:10883779-10883801 CTGTTATTGTAGGTGTGTGGTGG - Intergenic
1038164822 8:25075311-25075333 CTGTGATTGTTTCTGTCTCCAGG + Intergenic
1039545826 8:38410528-38410550 CAGTGATGCTAGATGTGTCCTGG + Intergenic
1039757946 8:40543133-40543155 CTGTGTTTGTAGCTGGGTGCTGG - Intronic
1044543270 8:93431254-93431276 CTGTGTTGTTAGCTGTGTACAGG - Intergenic
1045062685 8:98423049-98423071 CTGTGCTTGGAGCTGTGGTCTGG - Intronic
1045080852 8:98624312-98624334 CTATCAGTGTAGCTGTGTCTTGG + Intronic
1045403189 8:101839200-101839222 CTGTGATGGTAGTGGTGTGCAGG + Intronic
1049602077 8:143512655-143512677 GTGTGACTGGAGCTGTGTCCGGG - Intronic
1050612125 9:7363770-7363792 CTGTGATTGTATCTGGGTATTGG - Intergenic
1056060288 9:82878322-82878344 GTGTGATTGTAGCTGTTCCCTGG - Intergenic
1056286645 9:85093879-85093901 ATCTGATTGTGGCTGTGTTCTGG + Intergenic
1058774612 9:108271427-108271449 CTGTGATTTTCTCTGTGACCTGG - Intergenic
1203691757 Un_GL000214v1:48716-48738 CTGTAACTATAGCTGAGTCCTGG - Intergenic
1203710313 Un_KI270742v1:92057-92079 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1203644538 Un_KI270751v1:55475-55497 CTGTAACTATAGCTGAGTCCTGG + Intergenic
1186844576 X:13517938-13517960 CGGTGATTGTATTTGTGGCCAGG - Intergenic
1187927658 X:24264708-24264730 CTGGGATAGGAGCTGGGTCCAGG - Intergenic
1188252397 X:27913598-27913620 CTGTCCTTGTAGCTGTGGCAGGG - Intergenic
1189605686 X:42675292-42675314 CTGGGGCTGTAGCTGTGTGCAGG + Intergenic
1193807577 X:86013106-86013128 CTGTCAGTATGGCTGTGTCCGGG - Intronic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197647507 X:129033946-129033968 CTGTGTATGTAGGTGGGTCCAGG - Intergenic
1201050382 Y:9926910-9926932 CTGTTATTATAGCTATATCCTGG - Intergenic
1201416365 Y:13752325-13752347 GTGTGGATGTAGCTGTTTCCCGG + Intergenic