ID: 1064296695

View in Genome Browser
Species Human (GRCh38)
Location 10:14085104-14085126
Sequence ATTTATAAACAGATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064296695_1064296699 3 Left 1064296695 10:14085104-14085126 CCCACCTCCATCTGTTTATAAAT 0: 1
1: 0
2: 0
3: 25
4: 360
Right 1064296699 10:14085130-14085152 GAAGTGTTCATCACATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064296695 Original CRISPR ATTTATAAACAGATGGAGGT GGG (reversed) Intronic
901183937 1:7360101-7360123 ACTTATAAAAAGGTGGGGGTTGG - Intronic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
904518605 1:31076632-31076654 ATTTAAAAATATATGTAGGTGGG + Intergenic
904766462 1:32852508-32852530 AGTTTAGAACAGATGGAGGTGGG - Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905401419 1:37706402-37706424 GTTGATGAACAGATGGAGGCCGG - Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906945506 1:50291098-50291120 ATTTAACAACAGATGGATGATGG - Intergenic
907079108 1:51604950-51604972 ATTTATAAAAACATGAAGCTAGG - Intronic
907237644 1:53062758-53062780 ATCTATAAAGAGGTGGAGGTTGG - Intronic
907281489 1:53349975-53349997 ATTTGTAAAGAAATGGGGGTGGG - Intergenic
908648218 1:66302893-66302915 AGTTACACACAGATAGAGGTTGG - Intronic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
909135143 1:71789115-71789137 AGTTATACACATATGGAGGCTGG + Intronic
909813648 1:79962727-79962749 AGTAATAAAAAGATGGAGGTAGG + Intergenic
909993982 1:82256235-82256257 ATTTTTAAACAGATCGAAATTGG + Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910786864 1:91008425-91008447 ATCTACAAACAAATGGAGGTAGG + Intronic
911571991 1:99528502-99528524 ATTCACAAACAGGTGGAGGATGG - Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
912701429 1:111881215-111881237 GATTAAAAAAAGATGGAGGTGGG - Intronic
912760650 1:112363676-112363698 ATTTATAATCAGATGGCAGCTGG - Intergenic
916869892 1:168902352-168902374 TTATATAAACAGATTGGGGTTGG + Intergenic
918601449 1:186367469-186367491 ATTTATAAACAGACTGAAGGAGG - Intronic
919032521 1:192261290-192261312 ATTTATAAATTGATTTAGGTTGG - Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
923084047 1:230688699-230688721 ATTGATGAAGAGAGGGAGGTTGG + Intronic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
1063413989 10:5858284-5858306 ATTTAATATTAGATGGAGGTGGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065830631 10:29610755-29610777 ATTCATGAAAAGATGGAGGTTGG - Intronic
1066493020 10:35912884-35912906 TTTAAAAAACAGATGGAGATGGG + Intergenic
1068128330 10:52867997-52868019 ACTTATTAACAGGTAGAGGTTGG + Intergenic
1069448205 10:68494108-68494130 ATTAAGAAATAGATGGAGTTGGG - Intronic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1070972017 10:80575458-80575480 ATTTAGAAACAAAGGGATGTGGG + Intronic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074010234 10:109471158-109471180 ATTTCAGAACAGATGGATGTAGG - Intergenic
1074325253 10:112444916-112444938 ATTAAAAAAAAGATGGAGGTGGG - Intronic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1076323356 10:129600530-129600552 ATTTCTTAAGAGAGGGAGGTTGG + Intronic
1077261291 11:1622294-1622316 ATTTAGAAACATAAGCAGGTGGG - Intergenic
1077659942 11:4058929-4058951 ATTTATAAATGGTAGGAGGTGGG + Intronic
1079780445 11:24595668-24595690 ATTTATAAATAAATGAAGCTAGG + Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080559671 11:33451404-33451426 ATTTATAAATAGTTTCAGGTTGG - Intergenic
1080929815 11:36798086-36798108 ATTTAAAAACATATAGAAGTTGG - Intergenic
1081236307 11:40651335-40651357 AATTAAAAAGAGATGGGGGTGGG + Intronic
1081716839 11:45256464-45256486 ATGCAAAAACAGGTGGAGGTAGG - Intronic
1081844385 11:46228834-46228856 ATTTATCAACTGATGGACATCGG - Intergenic
1084343863 11:68529515-68529537 ATTTAAAAACAGATGCATGCCGG - Intronic
1087659219 11:100966344-100966366 ATATATAAAGAGATAGAGATTGG + Intronic
1088205337 11:107386339-107386361 ATTAGTATACAGATGTAGGTAGG - Intronic
1091390590 12:123854-123876 ATTTATAAAAATGGGGAGGTTGG + Intronic
1093007320 12:14064584-14064606 GTTTATAAACAGAGGGTGTTGGG + Intergenic
1093215606 12:16358133-16358155 ATTTAAAAAGAGATGGCAGTGGG - Intronic
1094480203 12:30875424-30875446 ATTTAAAAACAGATGGGGAAAGG - Intergenic
1095114959 12:38342460-38342482 TTTTATAAAGAGTTGGTGGTTGG + Intergenic
1097321824 12:58234070-58234092 GTATATCAACAGGTGGAGGTGGG - Intergenic
1098467212 12:70801196-70801218 AGTTGGAAACAGATGGAGTTGGG + Intronic
1098685819 12:73419148-73419170 TTTTATAAAGAGATGGGGGTAGG - Intergenic
1098919500 12:76290844-76290866 ATGAATAAAAATATGGAGGTGGG + Intergenic
1100182892 12:92104701-92104723 AATTAATAACAGATGTAGGTGGG + Intronic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1101340076 12:103835582-103835604 ATTTAGTAAGAGGTGGAGGTGGG - Intronic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1104154725 12:126120451-126120473 ATTTTCAACCAGATGGAGGAAGG - Intergenic
1104274729 12:127315557-127315579 ATTTTTAAATGGATGGATGTTGG - Intergenic
1105736412 13:23276307-23276329 ATTTTTAATAAAATGGAGGTGGG + Intronic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG + Intronic
1106726187 13:32488088-32488110 ATTAATAAACACATGGAACTAGG + Intronic
1108529881 13:51318950-51318972 AATCATAAAAAGATGGAGGAAGG - Intergenic
1109980863 13:69904386-69904408 ATTTATAAAGATATTGAGGAGGG - Intronic
1110750956 13:79115138-79115160 AATTATAAACGTATCGAGGTTGG - Intergenic
1111336339 13:86829186-86829208 ATTTATACCCAGATGTAGGATGG + Intergenic
1111543598 13:89700749-89700771 AATTCTACACAGATGGATGTGGG + Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1113929802 13:113962105-113962127 ATTAAAAAAGAGATGGAGGCTGG + Intergenic
1114837988 14:26226659-26226681 ATTTATTTACAGTGGGAGGTGGG - Intergenic
1116300475 14:43174716-43174738 AAATATAAACATATGGGGGTTGG - Intergenic
1116428305 14:44817230-44817252 AATTATCAACAGCTAGAGGTGGG + Intergenic
1118786728 14:69052205-69052227 ATTTATAAACACAAGGTGGTTGG - Exonic
1118920232 14:70143435-70143457 ATTTACAAACAGATGGGCCTGGG + Intronic
1119967550 14:78933956-78933978 ATTTACAAACAGCTGAAGATGGG - Intronic
1120227122 14:81803348-81803370 ATTTGTAGACAGATGGAAGCTGG - Intergenic
1121644348 14:95507572-95507594 GTTTTTACCCAGATGGAGGTGGG + Intergenic
1122162472 14:99793910-99793932 ATTTCCAAACAGATGTGGGTCGG - Intronic
1123441290 15:20294049-20294071 AGTTTTCAAGAGATGGAGGTGGG + Intergenic
1124272563 15:28295961-28295983 ATTTATAGCCAGATGTAGGGTGG - Intronic
1125243877 15:37611160-37611182 GTTTTTAAACGGATGGATGTAGG - Intergenic
1125403253 15:39326752-39326774 AGTTATGAGCAGATGGAGGGAGG - Intergenic
1125487470 15:40122296-40122318 TTTTATAAATAGATGAAGTTGGG - Intergenic
1125622915 15:41080557-41080579 TTTAATAAACAGATTGAGGCCGG + Intronic
1126220087 15:46203605-46203627 GTTTTTAATCAGATGGAGGCTGG + Intergenic
1126297375 15:47155380-47155402 ACTTTTAAACATATTGAGGTGGG + Intergenic
1127062971 15:55206282-55206304 ATTTATAAAAAGATATAAGTAGG + Intronic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1129078911 15:73022530-73022552 TTTTATAGGCAGTTGGAGGTGGG + Intergenic
1129179551 15:73865326-73865348 ATTTGCAAACAGATGGAGTTGGG + Intergenic
1129232501 15:74204522-74204544 ATTTAAAATCAGATGGGAGTTGG - Intronic
1129864234 15:78891254-78891276 ATTTATAAATAAATGGAAGATGG + Intronic
1131294771 15:91137302-91137324 ATTTTTAAAACAATGGAGGTGGG - Intronic
1133088805 16:3387357-3387379 AGATATAAACAGATAGAGATGGG - Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134359659 16:13519498-13519520 ATTTATAAAGACATGGTGCTTGG - Intergenic
1134848590 16:17461684-17461706 ATGCATAAATAGATGGAGGCAGG + Intronic
1135283356 16:21172031-21172053 ATTTATACACACTTGGAGCTGGG - Intronic
1136147469 16:28323727-28323749 ATTTACAAACACATGGAGGAAGG - Exonic
1136291695 16:29276797-29276819 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1136362244 16:29788397-29788419 ATTTTTTAAGAGATGGAGGTAGG + Intergenic
1138159436 16:54739609-54739631 ATATATAAACAGATACAGATAGG - Intergenic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139819757 16:69711989-69712011 ATTTCTATAAAGAGGGAGGTTGG - Intronic
1140870420 16:79101405-79101427 ATTTACAAATAGATGAAAGTTGG + Intronic
1141392180 16:83674203-83674225 TTTTATAACTAGATGAAGGTAGG + Intronic
1142097577 16:88250741-88250763 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1143570171 17:7753127-7753149 TATTAAAAACAGAAGGAGGTTGG + Intronic
1143975997 17:10830233-10830255 ATCTATAAACAGAAGCAGGCAGG + Intronic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1150745944 17:67816694-67816716 ATTAATTAAGAGATGGGGGTTGG + Intergenic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1155276357 18:24191375-24191397 ATTAATAGACAGATGGGAGTAGG - Intronic
1155520320 18:26661322-26661344 AATTATAAACAGGTGGTGGCTGG - Intergenic
1156080728 18:33331598-33331620 ATTTCTAATGAGATGTAGGTAGG - Intronic
1156157847 18:34324725-34324747 CTTTACAAACAGTTGGTGGTAGG + Intergenic
1156661999 18:39357312-39357334 ATGGATTATCAGATGGAGGTTGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1159519578 18:69500899-69500921 ATTTATAAACACATGTATTTTGG + Intronic
1160036237 18:75304276-75304298 ATTTGGAAAGAGATTGAGGTGGG + Intergenic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163140312 19:15343510-15343532 ATGTATAAACACATGTAGGCCGG + Intergenic
1163494198 19:17635294-17635316 ATTAATAAACAGATGGGGTCAGG - Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
925302894 2:2829552-2829574 ATTTCTAAACAAATGGAGTTGGG - Intergenic
926023179 2:9515007-9515029 ATTTAAAAACAGGTGGTGGCAGG - Intronic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
927304958 2:21560293-21560315 CTTTGTAAACAGTTGGAAGTTGG - Intergenic
928476964 2:31637447-31637469 ATTTATAAACTGTTGCTGGTGGG - Intergenic
929484876 2:42344253-42344275 ATTTTTAACCAGATGAAGGTGGG - Intronic
930118920 2:47743950-47743972 ATGTCTAGGCAGATGGAGGTGGG + Intronic
931020464 2:58039030-58039052 ATTTATATATTGATGCAGGTTGG + Intronic
931278572 2:60766663-60766685 TTTTTTAAACAGATGGAGACGGG - Intronic
931364151 2:61604080-61604102 AGTGATGAATAGATGGAGGTGGG + Intergenic
931587672 2:63845906-63845928 ATTAATAAAAATATTGAGGTAGG + Intronic
931677302 2:64710006-64710028 ATTTAAAATCAGAGGGAGGCTGG - Intronic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
937739192 2:125329641-125329663 TTTTATAAACAGATAGAAATTGG + Intergenic
939131080 2:138236778-138236800 ATTTATAAAGAAAAAGAGGTGGG - Intergenic
939579825 2:143935084-143935106 AGTTATAAACAGATGGTATTTGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
940211880 2:151263432-151263454 ATTTTAAAACAGAATGAGGTAGG + Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940657052 2:156500303-156500325 ATTTATAAAGAGATGGCTGAAGG + Intronic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
942374408 2:175322368-175322390 ATTTAAAAACAGATAAAAGTTGG - Intergenic
942852438 2:180505028-180505050 ATTTAGAAAGAGGTGGAGGGTGG - Intergenic
942860510 2:180604482-180604504 ATGTATAAACTGTTGGATGTGGG + Intergenic
943353438 2:186822200-186822222 ATTTAAAAACCCATGGAAGTGGG + Intergenic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
943963026 2:194291650-194291672 AATTAGAAACTGATGTAGGTGGG - Intergenic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
946713658 2:222531704-222531726 ATTAATAGATATATGGAGGTGGG + Intronic
1169301158 20:4443107-4443129 ATTTATAAACTGCGGGTGGTAGG + Intergenic
1169963267 20:11186972-11186994 ATTTTTAAAGAGTTGGAGGAAGG - Intergenic
1170224475 20:13976467-13976489 ATTGAGAAAGACATGGAGGTGGG + Intronic
1170925611 20:20720618-20720640 ATTTATAAAAAGACAGAGGGGGG - Intergenic
1171105594 20:22429749-22429771 ACTGATAAACAGATGGGGGCTGG + Intergenic
1171567873 20:26211018-26211040 ATTTTTAAACATATTGAAGTTGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173925359 20:46777165-46777187 ATTGAAAAACAGATTGAAGTTGG + Intergenic
1176894781 21:14363641-14363663 ATTTATATATAAATGGATGTGGG + Intergenic
1176947796 21:15004890-15004912 ATTTATAATGTGTTGGAGGTGGG - Intronic
1179421355 21:41239171-41239193 GTTTATGAGCAGATGGGGGTGGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
949327212 3:2880202-2880224 ATTTATAGACAGAGAGAGGCTGG + Intronic
951189703 3:19753908-19753930 ATTTAAAAAAAAATGGAAGTGGG + Intergenic
951217423 3:20038932-20038954 ATATATAAACATTGGGAGGTGGG - Intergenic
951519142 3:23594927-23594949 ATTTTTAAAAAGATGGATGAGGG - Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
952894204 3:38065870-38065892 ATTTTTAAAAAGCAGGAGGTGGG - Intronic
957110998 3:75957166-75957188 ATTTTTAAACATATTGAAGTTGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
958425188 3:93971467-93971489 ATTTAAAATCATATGGAGGCTGG + Intronic
959077688 3:101766948-101766970 TTTTTTAAAGAGATGGAGGCTGG + Exonic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
959854737 3:111138380-111138402 TTTTAAAAACAGATGAAAGTTGG - Intronic
960826900 3:121796771-121796793 ATTTATAAACAGATGTAAATGGG + Intronic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963704512 3:148669368-148669390 ATTTGAACACAGATGTAGGTAGG - Intergenic
964465801 3:156990599-156990621 ATAAATAAATAGATGAAGGTAGG - Intronic
964541919 3:157789094-157789116 GTTTATAAACAGATAAAAGTAGG - Intergenic
964630048 3:158800793-158800815 ATTTAGAGAGAGAAGGAGGTAGG - Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965087277 3:164114652-164114674 GATTATAAACAGTGGGAGGTAGG + Intergenic
965664610 3:171079712-171079734 AATTAGAAATAAATGGAGGTGGG - Intronic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
971091188 4:23347483-23347505 ATTTAACAACAGAGGGATGTTGG + Intergenic
971131312 4:23813977-23813999 ATTTATAAACATAGGTAGTTTGG + Exonic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
971965000 4:33542394-33542416 ATTTATACAAAGAAGGGGGTAGG - Intergenic
974919296 4:68218449-68218471 ATTGATTTACAGAGGGAGGTAGG + Intergenic
975383471 4:73728824-73728846 ATTTTTAAAAAGATGGAGAGGGG - Intergenic
975558943 4:75691584-75691606 AGTAATAAATAGGTGGAGGTCGG - Intronic
976097353 4:81523351-81523373 TTTTTTTAACAGATGGAGATAGG + Intronic
977923085 4:102667394-102667416 ACTTAAAACCAGATGGATGTGGG + Intronic
979110647 4:116750565-116750587 AATTACTAACAGATGGGGGTTGG - Intergenic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
979519775 4:121652874-121652896 ATATATCAACAGATGGGAGTAGG + Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980092216 4:128454818-128454840 TTTTATAAACACAGGAAGGTGGG + Intergenic
980842031 4:138275334-138275356 ATTGATATACAGATGAAGCTTGG - Intergenic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981757079 4:148152379-148152401 ATTTCTAAACAGATGTACGTTGG - Intronic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
984031859 4:174613740-174613762 ATTTATAAACCAATGGAGGGTGG - Intergenic
984077297 4:175199049-175199071 ATTTTTAAACAAATGGTGCTGGG - Intergenic
984079538 4:175228900-175228922 ATTTCTAAATAAATGAAGGTTGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985163766 4:187070994-187071016 ATTTATATGTAAATGGAGGTTGG - Intergenic
986577821 5:9230683-9230705 TTTTATAAAATGATGGAGGGTGG + Intronic
987067999 5:14308515-14308537 ATGGATAAATGGATGGAGGTTGG - Intronic
987246634 5:16055492-16055514 ATATATATATAGTTGGAGGTGGG - Intergenic
989782683 5:45288253-45288275 ATTTAAAAAGAAATGGAGGTAGG - Intronic
990285912 5:54300450-54300472 AGTTGTAATCAGATGGAGGGTGG - Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990960884 5:61392622-61392644 ATTTATATTGAGATGGAGTTCGG + Intronic
990998098 5:61753542-61753564 ATTTAATAAAAAATGGAGGTGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991913016 5:71580183-71580205 ATTTAAAAAAAGATGTAGGCCGG - Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
994096970 5:95856300-95856322 GTTTATAAACATGTGGAGGAAGG - Intronic
994154192 5:96484393-96484415 ATTTAAAAACAGATGTAGAAGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994348776 5:98720037-98720059 ATTTATTTAGAGATGGAGCTTGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994910350 5:105897519-105897541 ATTAATAAACAGAAGGACATTGG + Intergenic
995440883 5:112191066-112191088 TTTTATAACCAGATAGAAGTTGG - Intronic
995759425 5:115547620-115547642 ATTAATAAGTAGATGGAGGCTGG - Intergenic
995821171 5:116234684-116234706 ATTTACACACAGATCGAGTTAGG + Intronic
995955954 5:117776440-117776462 ATTAAGAAACAGATGGTGTTTGG - Intergenic
996733302 5:126736550-126736572 AATTAGAAACAGCTGGAGGCAGG - Intergenic
997321868 5:132984252-132984274 AAGAATAAACAGATGGGGGTGGG - Intergenic
997656705 5:135560489-135560511 ATTTAATATAAGATGGAGGTAGG - Intergenic
997737799 5:136227279-136227301 GTTTGTAAACAGATGGACCTGGG + Intronic
998437197 5:142121289-142121311 ATTTCTAAAGAGATAAAGGTTGG + Intronic
998493448 5:142566586-142566608 GTTTATAAAAAGATAGAGGTTGG + Intergenic
999224026 5:150005020-150005042 ATTTATAAACAGAAGTTGCTTGG + Intronic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1001968057 5:175927862-175927884 ATTTTTATCAAGATGGAGGTTGG - Intronic
1002249387 5:177915944-177915966 ATTTTTATCGAGATGGAGGTTGG + Intergenic
1002286347 5:178165106-178165128 ATTTATAAAAACATGGGGGCCGG + Intergenic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1005513622 6:26534176-26534198 TTTTATAAAAAGATGCAAGTCGG + Intergenic
1006972003 6:38055285-38055307 ATTTATAGTCAGATGGGGTTTGG + Intronic
1007202468 6:40121465-40121487 ATTTATCAACAGATCAAGGAGGG - Intergenic
1007881189 6:45168618-45168640 ATTTAAAAACAGATGCAGCCAGG - Intronic
1007984610 6:46195439-46195461 ATTTAGAATCAGATGGATATGGG + Intergenic
1008051957 6:46909332-46909354 ATTTAAAAAGAGAAGGAGATCGG - Intronic
1009382378 6:63048495-63048517 ATTTTTAAAAAGAAGGAGTTTGG - Intergenic
1010240188 6:73608157-73608179 ATTGCTACACAGATGGGGGTGGG - Intronic
1010756443 6:79671054-79671076 ATTTAGAAAGAGAGGGAGATTGG + Intronic
1011142016 6:84168723-84168745 ATTTATCAATAGAAGGAGTTTGG - Intronic
1011648964 6:89488239-89488261 GTTTATAATCAAATGCAGGTGGG - Intronic
1011667414 6:89647974-89647996 ATTTTTAAACTGGTGTAGGTTGG - Intronic
1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG + Intronic
1012689078 6:102291868-102291890 ATTAAAAAACAAAAGGAGGTGGG - Intergenic
1013066902 6:106692903-106692925 AATTAAAAACAAATAGAGGTGGG - Intergenic
1013647445 6:112159635-112159657 GTTTACAATCAGATGGGGGTGGG - Intronic
1014077730 6:117256209-117256231 ATTTAGAAAAAGATACAGGTAGG - Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014719795 6:124902520-124902542 ATTTATAATCATTTGGGGGTTGG - Intergenic
1015078899 6:129199118-129199140 TTTTATAAACTGATGGATTTGGG - Intronic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016475190 6:144419500-144419522 GTTTAAAAACAGATAGAGGGAGG + Intronic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017609019 6:156164652-156164674 ATTTGTAGAGAAATGGAGGTGGG + Intergenic
1017976807 6:159365445-159365467 ATTTATATGTTGATGGAGGTGGG + Intergenic
1018299153 6:162381661-162381683 ATTTATAAAGAGATAGTGGGGGG - Intronic
1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG + Intronic
1019295919 7:274871-274893 TTTTATGAACAGATGGATTTTGG - Intergenic
1019970958 7:4540334-4540356 ATCTATAAACTGATGGGGTTTGG + Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1020533718 7:9367195-9367217 ATTTAGAAACAAATGAAAGTAGG + Intergenic
1020920547 7:14258459-14258481 ATTTATAAACAGCTGAAATTAGG + Intronic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1021490208 7:21211326-21211348 GTTTAGGAACAGATAGAGGTAGG + Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1026281462 7:68925879-68925901 ATATATAAACAGATCAAAGTGGG - Intergenic
1027410548 7:77913089-77913111 ATTTAAAAAGAGATAGAGGCTGG + Intronic
1027562454 7:79748983-79749005 ATGTATAAACAAATAGGGGTTGG - Intergenic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1027804638 7:82801581-82801603 ATTTCTAAACAGAGGGAAGATGG - Exonic
1028510036 7:91614395-91614417 ATTTATTATCAGTTGGTGGTGGG - Intergenic
1028577141 7:92364582-92364604 ATATATAAAGAAATGCAGGTAGG - Intronic
1028965916 7:96800992-96801014 CTTTATAAATTGATGGAGGGAGG + Intergenic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1029598903 7:101552435-101552457 ATTTTTATAGAGATGGGGGTGGG - Intronic
1029835690 7:103307186-103307208 ATTTTTAAAAAGCTGGAGCTGGG - Intronic
1030645978 7:112062229-112062251 ATTTTTAAAAATATTGAGGTTGG - Intronic
1033006305 7:137568261-137568283 ATTTACAAACATTTGGAAGTAGG - Intronic
1033647420 7:143316077-143316099 GTCTATAAATAGCTGGAGGTGGG + Intergenic
1034295819 7:149971595-149971617 GTATATAAACAGAAGCAGGTAGG + Intergenic
1034810233 7:154125309-154125331 GTATATAAACAGAAGCAGGTAGG - Intronic
1035411355 7:158645308-158645330 ATATAAAAACAGATGCAGGGTGG + Intronic
1035460856 7:159037869-159037891 ATCTATAGACATATGTAGGTGGG + Intronic
1036384276 8:8264811-8264833 ATTTATTAAGACATTGAGGTAGG - Intergenic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1038054054 8:23841420-23841442 ATTTAGAAAGAGTTGGAGGAGGG - Intergenic
1039177264 8:34823997-34824019 ATTTGCAAACAGAGGGATGTGGG - Intergenic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1041108654 8:54466099-54466121 TTTTAAAAACAGATTGGGGTTGG + Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1041395142 8:57382856-57382878 ATATATAAAGAGAGGGAGGCAGG + Intergenic
1042903545 8:73750529-73750551 ATTTTTAATTAAATGGAGGTGGG - Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1043931810 8:86099881-86099903 ATTTATAAACATTTGGAGAAGGG + Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045363336 8:101452959-101452981 AGTTATAACCAGACAGAGGTTGG + Intergenic
1045994673 8:108349033-108349055 ATATATTAATAAATGGAGGTGGG + Intronic
1047021664 8:120781657-120781679 ATTCATAAAAAGAGGTAGGTTGG - Intronic
1047612968 8:126539071-126539093 ATTTAAAAATAGATGCAGGCCGG + Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1047650371 8:126913914-126913936 TTTTAAAATCAGATTGAGGTTGG - Intergenic
1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG + Intergenic
1047849950 8:128845962-128845984 ATTTATAAATAAATGGTGGCTGG + Intergenic
1048703440 8:137121262-137121284 ATAAATAAATAGATAGAGGTTGG + Intergenic
1049233401 8:141495862-141495884 ATTTATGAATAGATGGATGTTGG - Intergenic
1049970719 9:819783-819805 ATTTAAAAACGGATGGATGGTGG + Intergenic
1050102494 9:2133712-2133734 ATTCATTAAGAGGTGGAGGTGGG + Intronic
1051034407 9:12725587-12725609 ATATATAAAATGATGGAGGCCGG - Intergenic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1053450395 9:38189001-38189023 ATATATAAACAGATAGTAGTTGG - Intergenic
1055178868 9:73357833-73357855 AGATATCAACAGATGGCGGTTGG - Intergenic
1055793376 9:79947553-79947575 ATCTCTACACAGATGGAGTTTGG - Intergenic
1056972379 9:91217272-91217294 ATTAATCAAGGGATGGAGGTAGG - Exonic
1057028218 9:91752858-91752880 ATTGATGGACAGATGGAGGCTGG + Intronic
1057096004 9:92310378-92310400 GTTCATAAGTAGATGGAGGTAGG - Intronic
1057113668 9:92500086-92500108 ATTTATTTATACATGGAGGTAGG + Intronic
1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG + Intergenic
1058659139 9:107252969-107252991 ATGTTCAAAAAGATGGAGGTAGG + Intergenic
1060649748 9:125315165-125315187 ATTGATAAAGTGATGGTGGTTGG + Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062251207 9:135595526-135595548 AGTAATAAAAAGGTGGAGGTAGG + Intergenic
1187414098 X:19077199-19077221 ATTTAAAAACAAATGCAGGCCGG + Intronic
1187645142 X:21339445-21339467 ATTTATAAAAACATGGACGGGGG + Intergenic
1189565008 X:42232542-42232564 ATTTATAAATAATTGAAGGTTGG + Intergenic
1189927878 X:45975749-45975771 AAATATAAACACATGGAGGGGGG + Intergenic
1189993119 X:46613132-46613154 ATCTATAAACATATGGAAGATGG + Intronic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG + Intergenic
1193912684 X:87325279-87325301 ATTTCAAAACTGAAGGAGGTGGG + Intergenic
1194197356 X:90911510-90911532 AATTATAAACACATGTTGGTGGG + Intergenic
1195353790 X:104019136-104019158 ATTTATTGATAGAAGGAGGTTGG + Intergenic
1195725792 X:107914842-107914864 ATTTAGAATCAGATGGACATGGG + Intronic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1195976459 X:110532759-110532781 ATTTAGAAACATCTGGAGGCTGG - Intergenic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1197590739 X:128406923-128406945 ATTTAAAAACAGGTGTAGATTGG + Intergenic
1200544363 Y:4501283-4501305 AATTATAAACACATGTTGGTGGG - Intergenic