ID: 1064297599

View in Genome Browser
Species Human (GRCh38)
Location 10:14092435-14092457
Sequence CTGGGAATGGACTCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064297596_1064297599 -8 Left 1064297596 10:14092420-14092442 CCCAGTGAGGCAGGGCTGGGAAT 0: 1
1: 0
2: 5
3: 23
4: 306
Right 1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG No data
1064297597_1064297599 -9 Left 1064297597 10:14092421-14092443 CCAGTGAGGCAGGGCTGGGAATG 0: 1
1: 0
2: 4
3: 48
4: 1150
Right 1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG No data
1064297591_1064297599 3 Left 1064297591 10:14092409-14092431 CCGACTGGGAGCCCAGTGAGGCA 0: 1
1: 0
2: 0
3: 33
4: 207
Right 1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064297599 Original CRISPR CTGGGAATGGACTCTGTTGC TGG Intronic
No off target data available for this crispr