ID: 1064300610

View in Genome Browser
Species Human (GRCh38)
Location 10:14119527-14119549
Sequence CAGATCAGGGAGCAGTAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064300604_1064300610 29 Left 1064300604 10:14119475-14119497 CCTGGGCTGCTGATGGTGATGTT No data
Right 1064300610 10:14119527-14119549 CAGATCAGGGAGCAGTAGTGAGG No data
1064300606_1064300610 4 Left 1064300606 10:14119500-14119522 CCGTAACACATTGGCAGCATTTG 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1064300610 10:14119527-14119549 CAGATCAGGGAGCAGTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064300610 Original CRISPR CAGATCAGGGAGCAGTAGTG AGG Intronic
No off target data available for this crispr