ID: 1064303898

View in Genome Browser
Species Human (GRCh38)
Location 10:14148084-14148106
Sequence GCACAATACACATTAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064303898_1064303901 -2 Left 1064303898 10:14148084-14148106 CCCTCCATTAATGTGTATTGTGC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1064303901 10:14148105-14148127 GCAATTTGTACAATGTCACGAGG No data
1064303898_1064303902 4 Left 1064303898 10:14148084-14148106 CCCTCCATTAATGTGTATTGTGC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1064303902 10:14148111-14148133 TGTACAATGTCACGAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064303898 Original CRISPR GCACAATACACATTAATGGA GGG (reversed) Intronic
900795438 1:4705445-4705467 GCACAATGCACATTCTTGGAGGG - Intronic
902726372 1:18338844-18338866 GCATTATACACAGTCATGGAAGG + Intronic
905552673 1:38856451-38856473 GCTCAACAAACATTTATGGAGGG - Intronic
906550799 1:46665099-46665121 GCAGGATAAACATTTATGGATGG + Intronic
908877254 1:68691605-68691627 TTACAGTACACATAAATGGAGGG + Intergenic
909699126 1:78500842-78500864 ACACCATACACTTTTATGGAGGG - Intronic
910505680 1:87947734-87947756 GAACAATAAACATTTATTGAAGG + Intergenic
910842851 1:91577495-91577517 GCTCAATACATATTCATGAACGG + Intergenic
911578145 1:99602722-99602744 GCACATTTCATATCAATGGAAGG + Intergenic
911765233 1:101666454-101666476 GTAATTTACACATTAATGGAAGG - Intergenic
912211590 1:107562978-107563000 GCTCAATACACATTTGTAGAAGG + Intergenic
924280514 1:242432482-242432504 GCTCAATGCTCATAAATGGAAGG + Intronic
1064303898 10:14148084-14148106 GCACAATACACATTAATGGAGGG - Intronic
1064553496 10:16524955-16524977 ACTCAATACTGATTAATGGATGG - Intergenic
1065991263 10:31012615-31012637 GCTCAACACACATTTATTGAAGG + Intronic
1070998976 10:80812906-80812928 GAACAATACACATTAATGAGAGG + Intergenic
1071117754 10:82243056-82243078 GCACAATAAAATTTTATGGAAGG - Intronic
1073236155 10:102018203-102018225 GCAGAATACACAGAAAAGGAAGG - Intronic
1073581655 10:104672982-104673004 GGACAATATACATTAATAAAAGG - Intronic
1073673876 10:105623141-105623163 GAACAACACACATGAAGGGAGGG + Intergenic
1075932044 10:126307046-126307068 ACACAGTAGACATGAATGGAAGG - Intronic
1075952842 10:126496921-126496943 GCACACTGCACATTCCTGGACGG - Intronic
1078254326 11:9644587-9644609 GCTCAATACATATTTGTGGAAGG - Intergenic
1078923173 11:15850346-15850368 GCAGAATACAGATGAGTGGATGG + Intergenic
1083078851 11:60070084-60070106 GCACAGTAAACATCAATGAATGG + Intronic
1083112969 11:60430158-60430180 GGACAATATACAAAAATGGAAGG - Intronic
1089805879 11:121088473-121088495 GAAAAATACACATTAAAGAAAGG - Exonic
1090603343 11:128395180-128395202 GCACAGTACAAATTTATGGAGGG - Intergenic
1091190298 11:133688225-133688247 TCACAAAACAAATTAATGGCAGG - Intergenic
1093858302 12:24132807-24132829 GGATAAAACACATTAAAGGAGGG + Intergenic
1096246775 12:49994445-49994467 ACACAATGCACAACAATGGAGGG + Exonic
1097939795 12:65291581-65291603 GCTCAATACATATTTTTGGAAGG - Intronic
1099126408 12:78763455-78763477 TTACTATAAACATTAATGGAAGG + Intergenic
1099484670 12:83213996-83214018 TCCCAATACACATTACTGCAGGG - Intergenic
1101795455 12:107968975-107968997 GCAGAACTCACATTGATGGAGGG + Intergenic
1103886685 12:124207728-124207750 GCTCAATACACGTTCCTGGAAGG + Intronic
1104409448 12:128546047-128546069 TCTCATTACACATTAAAGGAAGG - Intronic
1109167151 13:59050362-59050384 GCACAATACACATTAGTTTTGGG + Intergenic
1110027313 13:70557069-70557091 AAACAATAAACATTGATGGAAGG + Intergenic
1110462710 13:75763242-75763264 GCTGAATACACTTTAATGCACGG + Intronic
1112012766 13:95305876-95305898 GCAATATACAAATTAAAGGATGG + Intergenic
1112480732 13:99772948-99772970 GCACAATCTACATTCAGGGATGG - Exonic
1113334163 13:109362406-109362428 GCAGAATACATATTAATTTAAGG + Intergenic
1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG + Intronic
1120327089 14:83044033-83044055 GCTGAATACAGATTAATAGATGG + Intergenic
1123465954 15:20515971-20515993 GATTAATGCACATTAATGGATGG - Intergenic
1123652160 15:22485068-22485090 GATTAATGCACATTAATGGATGG + Intergenic
1123742580 15:23293928-23293950 GATTAATGCACATTAATGGATGG + Intergenic
1123760745 15:23430558-23430580 GATTAATGCACATTAATGGATGG - Intergenic
1124276678 15:28331947-28331969 GATTAATGCACATTAATGGATGG - Intergenic
1124306022 15:28579659-28579681 GATTAATGCACATTAATGGATGG + Intergenic
1127332262 15:57950793-57950815 GCAGAATAAACATTTGTGGAGGG + Intergenic
1129893321 15:79086479-79086501 GCACAGGACACATTACTGGTTGG - Intronic
1130767491 15:86886392-86886414 ACACCATACACAGAAATGGAAGG - Intronic
1134739303 16:16528656-16528678 GCACTATAAACATTACTGAATGG - Intergenic
1134928197 16:18183495-18183517 GCACTATAAACATTACTGAATGG + Intergenic
1136173261 16:28500901-28500923 ACACAAAACACATTCATGGCTGG + Intronic
1139132854 16:64167090-64167112 GCATAAAACACATTCATGTAAGG - Intergenic
1141425997 16:83944995-83945017 GCTCCATAAACATTAATTGAAGG - Intronic
1142134961 16:88447618-88447640 GCTCAAGACATATTTATGGATGG + Intergenic
1147728571 17:42582192-42582214 GCAGGATCCATATTAATGGAAGG + Exonic
1149863279 17:60136261-60136283 GCACAATACATATTTGTGGATGG - Intergenic
1152549055 17:81020195-81020217 GGACAATACATATTAGTGGCTGG + Intergenic
1153109633 18:1569668-1569690 GGACAATATACCTTATTGGAAGG - Intergenic
1155253021 18:23969398-23969420 GCATAATAAATATTCATGGAAGG + Intergenic
1156818271 18:41339130-41339152 GCACCATGCAAATTAATGCAAGG + Intergenic
1159982355 18:74799345-74799367 GATTAATTCACATTAATGGAAGG - Intronic
1164191749 19:22924362-22924384 TCACAATACCCTCTAATGGAAGG - Intergenic
1167770847 19:51516339-51516361 GCCTAATCCACATTTATGGAGGG - Intergenic
1168499629 19:56882533-56882555 GCACGACATACATTACTGGAGGG - Intergenic
931865460 2:66405507-66405529 GCACAATCCACACTTAAGGAGGG - Intergenic
932115927 2:69047082-69047104 GCAAAATCCACATATATGGAGGG + Intronic
934945251 2:98536585-98536607 GCTCAATAAATATTTATGGAAGG + Intronic
939112002 2:138019539-138019561 CCACAATAGCCTTTAATGGAAGG + Intergenic
940533862 2:154913597-154913619 AAACAATACACATTTATAGATGG + Intergenic
941038838 2:160598001-160598023 GCATAATTAACATTAATTGAAGG + Intergenic
941311995 2:163944979-163945001 GCACAATGCACATTAACAAATGG + Intergenic
941540579 2:166778656-166778678 ACACAATGCACATAAATTGAAGG - Intergenic
942436649 2:175985158-175985180 ACAGAAAACAGATTAATGGATGG + Intronic
945070138 2:205981192-205981214 GCAGAATACACACCAATGGCTGG + Intergenic
945332910 2:208560391-208560413 AAACAATACACATTCATGGCCGG + Intronic
947403728 2:229753506-229753528 GCTCAATGTACTTTAATGGAGGG + Intergenic
947738199 2:232470073-232470095 GCACAATATACAAAAATGCATGG - Intergenic
947924144 2:233906278-233906300 GCACATCAAACCTTAATGGAAGG - Intergenic
1169807802 20:9577206-9577228 GCAAAATACACTTAAATGTAGGG + Intronic
1174503500 20:51002402-51002424 GCTCAATAAACATTTATTGAAGG - Intergenic
1178532389 21:33386381-33386403 GCAGAAAACAAATTAATGGAAGG - Intergenic
1181666699 22:24403468-24403490 GGAAAATGCACATTAACGGAAGG - Intronic
1184336600 22:43857051-43857073 GGACAACACACATGAATAGATGG + Intronic
1185223077 22:49638897-49638919 GAACAATTCAAATCAATGGATGG - Intronic
956012511 3:64846405-64846427 GTAAAAACCACATTAATGGATGG + Intergenic
956846362 3:73187039-73187061 GCAAAATATACATTCATGCAGGG + Intergenic
957607142 3:82415771-82415793 TCAAAACACACATTAATGTATGG - Intergenic
959381292 3:105644085-105644107 GAACAATACACCTTTATGTAGGG + Intergenic
960204418 3:114877911-114877933 GGACAATACTCAGTAAAGGAAGG + Intronic
961424860 3:126837009-126837031 GCACAATTCCCTTTAGTGGAGGG - Intronic
962584913 3:136832490-136832512 GTACTATGCACATTAAAGGAAGG - Intronic
964577163 3:158184406-158184428 GTACAATACACAATAATACAGGG + Intronic
969260630 4:6031087-6031109 GCAGCATACACATAAATAGAAGG + Intronic
974361739 4:60889821-60889843 GCATAAAACAGATTATTGGAGGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
975766046 4:77668624-77668646 GCACAATAGACATAAATTGAAGG - Intergenic
976332610 4:83849929-83849951 GCTCTATACAAACTAATGGAAGG + Intergenic
979971055 4:127135967-127135989 ACACATTACACATTAATGTTGGG - Intergenic
980285667 4:130776092-130776114 AAATAATACACATGAATGGATGG - Intergenic
982412682 4:155096992-155097014 CCAAAATGGACATTAATGGAAGG - Intergenic
983690175 4:170459624-170459646 ACACAAAACACATTATTTGAAGG + Intergenic
986661121 5:10061126-10061148 TCACAATACACATTATAGAAAGG + Intergenic
987789397 5:22545223-22545245 GCTCAATACCCATCAATGGTGGG + Intronic
988465304 5:31484999-31485021 GCAAAATATACATTAACTGAAGG + Intronic
991137510 5:63199494-63199516 GCAAACTACACATAAATGGATGG + Intergenic
993335857 5:86657768-86657790 GAGCCATACACATTAATGGATGG + Intergenic
993589868 5:89781066-89781088 ACACAATACAAAATAATGAAGGG + Intergenic
994064851 5:95527305-95527327 ACACAAAACACATTATTGGTGGG + Intronic
998033001 5:138889455-138889477 GCACAGTGCTCATTATTGGAGGG - Intronic
998191128 5:140025443-140025465 GCTCAATAAACATTAACTGAGGG - Intronic
1000555435 5:162719327-162719349 GGACAAAACACATTAATAGTAGG + Intergenic
1003448266 6:6205221-6205243 GCACAAGAGACCTCAATGGAGGG + Intronic
1011605210 6:89097018-89097040 GTACAATATACATTAATTTATGG + Exonic
1011679700 6:89771073-89771095 GCACCATACACACTGATGGTGGG + Intronic
1012457202 6:99420609-99420631 GCACAACACACAGTAATCAATGG + Intronic
1012639916 6:101597208-101597230 GAACAGTAGACATTAATAGAGGG + Intronic
1013108083 6:107043029-107043051 TCAGAATAAACATTAATGGAGGG + Intronic
1018252467 6:161884923-161884945 GCACTAGACACATAAATGAATGG + Intronic
1018545861 6:164934608-164934630 GAACAATACACATGAAAGGCAGG + Intergenic
1020768973 7:12363277-12363299 GTGCAATTCACATGAATGGAGGG + Intronic
1023667217 7:42536357-42536379 GCACAAAGCACATTTATGGATGG - Intergenic
1024781394 7:52854540-52854562 GCAAAATACACATTATATGATGG + Intergenic
1028415969 7:90580912-90580934 GCACAATAAACATTAAGGCCGGG - Intronic
1030375999 7:108754399-108754421 GCAAAATACACAGAATTGGAAGG + Intergenic
1033734388 7:144207730-144207752 GCTCTATACAAACTAATGGAAGG + Intergenic
1033748664 7:144343239-144343261 GCTCTATACAAACTAATGGAAGG - Intergenic
1037537160 8:19835496-19835518 GCACAATAGGCATTCAGGGAAGG + Intronic
1039397043 8:37235315-37235337 GCTCAATACATATTTGTGGAAGG + Intergenic
1039584853 8:38698127-38698149 GCAGACTACTCATTAATAGATGG + Intergenic
1040599016 8:48866119-48866141 GCACAATACCCATTGATAAAAGG - Intergenic
1041143340 8:54845340-54845362 GCACAAGACTCATCAACGGATGG + Intergenic
1041148462 8:54905575-54905597 GTATAATACTTATTAATGGATGG + Intergenic
1041738720 8:61137297-61137319 GCAGAGTAAACATTCATGGAGGG + Intronic
1043219504 8:77641662-77641684 ACACAAAACACAGAAATGGATGG - Intergenic
1048022874 8:130556529-130556551 GCACAAAACAGATTAAGGCAAGG + Intergenic
1050049251 9:1581976-1581998 GCTCAATAAACATTTATGTATGG - Intergenic
1051228590 9:14929485-14929507 GCATAAAACACATTAATTAAGGG + Intergenic
1057567068 9:96174218-96174240 ACACAGTACACATGAATGGTGGG - Intergenic
1060930959 9:127489337-127489359 GTACAAAGCACCTTAATGGATGG - Intronic
1185433243 X:21574-21596 TCAAAATAAACATTAATGGCCGG + Intergenic
1185442447 X:233642-233664 TCAAAATAAACATTAATGGCCGG + Intergenic
1188947325 X:36322011-36322033 GCACAATATAGATAAATTGAAGG - Intronic
1191791009 X:64971913-64971935 ACGCAATACACATGAATGGATGG + Intronic
1193203788 X:78723940-78723962 GAACCTTACAAATTAATGGAGGG + Intergenic
1194382732 X:93215622-93215644 GCATTATACACAGTAATGGCAGG + Intergenic
1197359335 X:125479771-125479793 GCACAATAGACTGCAATGGAAGG - Intergenic
1198123394 X:133618148-133618170 GTACAATACACATGAATTTATGG + Intronic
1198560539 X:137845285-137845307 GCATAATCCTCATGAATGGAAGG - Intergenic
1199005291 X:142688764-142688786 GCACTCTACATATTCATGGAGGG + Intergenic
1199747009 X:150778296-150778318 GCCGAACACTCATTAATGGAGGG + Intronic
1199904761 X:152213840-152213862 CCAAAATACACATTAAGGGAAGG - Intronic
1200341726 X:155404112-155404134 GCAAAACTCACATTTATGGAGGG - Intergenic