ID: 1064307977

View in Genome Browser
Species Human (GRCh38)
Location 10:14185841-14185863
Sequence CTCTATGGGAAACCTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064307977_1064307985 25 Left 1064307977 10:14185841-14185863 CCATGGCCAGGTTTCCCATAGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1064307985 10:14185889-14185911 CAACAGGGCAGAGAGAGACTGGG No data
1064307977_1064307984 24 Left 1064307977 10:14185841-14185863 CCATGGCCAGGTTTCCCATAGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1064307984 10:14185888-14185910 GCAACAGGGCAGAGAGAGACTGG No data
1064307977_1064307981 -4 Left 1064307977 10:14185841-14185863 CCATGGCCAGGTTTCCCATAGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1064307981 10:14185860-14185882 AGAGTTAGAGTGAGATAAAGTGG No data
1064307977_1064307983 10 Left 1064307977 10:14185841-14185863 CCATGGCCAGGTTTCCCATAGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1064307983 10:14185874-14185896 ATAAAGTGGTAACAGCAACAGGG No data
1064307977_1064307986 29 Left 1064307977 10:14185841-14185863 CCATGGCCAGGTTTCCCATAGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1064307986 10:14185893-14185915 AGGGCAGAGAGAGACTGGGCAGG No data
1064307977_1064307982 9 Left 1064307977 10:14185841-14185863 CCATGGCCAGGTTTCCCATAGAG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1064307982 10:14185873-14185895 GATAAAGTGGTAACAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064307977 Original CRISPR CTCTATGGGAAACCTGGCCA TGG (reversed) Intronic
901744431 1:11363134-11363156 CTCTAGTGGATCCCTGGCCAAGG - Intergenic
904806788 1:33137791-33137813 TTCTGAGGGAAAGCTGGCCACGG + Intergenic
905557609 1:38899603-38899625 TTCTAAGGGAAACCTGGCTGTGG - Intronic
908580387 1:65510045-65510067 CCCTATGGAAAACCTGGGAATGG + Intronic
909026552 1:70487958-70487980 CTGTATGGGAATTCTGGCCAAGG - Intergenic
910095538 1:83517413-83517435 CTCCTTGTAAAACCTGGCCATGG - Intergenic
911658331 1:100470653-100470675 TTCTATGAGATATCTGGCCAAGG - Intronic
912949865 1:114113171-114113193 CTCTATGGAGCACCTTGCCATGG - Intronic
913035074 1:114956645-114956667 CTGTATGGGAATGCTGACCAGGG - Intronic
913516353 1:119608790-119608812 CTATATTGGAAACATGGCCTGGG + Intergenic
917704049 1:177613354-177613376 CTGTCTGGGGAAGCTGGCCAGGG - Intergenic
919817941 1:201453475-201453497 TTCTTTGGGAAGCCTTGCCAGGG - Intergenic
921874362 1:220177133-220177155 CTATTTGGGAATACTGGCCAGGG - Intronic
922035107 1:221840199-221840221 CTCTCTGGGATACTTGGTCAAGG + Intergenic
924384338 1:243488037-243488059 CCCTCTGGGAAACCCGGCGATGG - Intronic
1063904023 10:10764901-10764923 CTTTCTGGGGAGCCTGGCCAAGG - Intergenic
1064307977 10:14185841-14185863 CTCTATGGGAAACCTGGCCATGG - Intronic
1064598904 10:16973519-16973541 CTCTATAGCAAACCTGCACATGG - Intronic
1065329965 10:24585597-24585619 CTTCATGGAAAACCTTGCCAGGG + Exonic
1067010121 10:42703268-42703290 ATCTATGACAAACCTGACCATGG + Intergenic
1067313638 10:45140370-45140392 GTCTATGACAAACCTGACCACGG - Intergenic
1067421809 10:46158709-46158731 CTCTATGGGAACCCAGACCTGGG - Intergenic
1067507115 10:46864798-46864820 CTCTATGGGAACCCAGACCTGGG - Intergenic
1067559657 10:47295960-47295982 GTCTATGGGAGAGGTGGCCAAGG - Intergenic
1070569789 10:77632247-77632269 CACTTGGGGAAACCTGGCCTAGG + Intronic
1070859285 10:79637845-79637867 CTCTATGGGAACCCAGACCTGGG - Intergenic
1072299490 10:94045470-94045492 CTTTATGGATAAACTGGCCAAGG + Intronic
1072808415 10:98440803-98440825 CTTTATTGAAAACCTGGCAAAGG - Intronic
1075797395 10:125130403-125130425 CTCTTGGGGAACCGTGGCCAAGG - Intronic
1076735047 10:132455189-132455211 GCCCATGGGAAACCTGGTCAAGG - Intergenic
1083328918 11:61888120-61888142 CTCTCAGACAAACCTGGCCAAGG + Intronic
1086282106 11:85201425-85201447 CTGTGTGGGAAAGCTGGCCAGGG - Intronic
1087090173 11:94262350-94262372 CTTTGTGGGGAATCTGGCCAGGG + Intergenic
1090228072 11:125083501-125083523 CTCCAGGGGAAAGGTGGCCACGG + Intronic
1095238055 12:39822318-39822340 CTTTATGTGATACCTGGACATGG - Intronic
1098502590 12:71210853-71210875 CTTTATGGGGACCCTGGCTAAGG + Intronic
1101210882 12:102534280-102534302 CTCCATGGAAAACCTGGCCCTGG + Intergenic
1101993226 12:109504674-109504696 ATCTTTGGGAAACCTGCCCTAGG - Intronic
1102281226 12:111620521-111620543 CTCAATGGGAAGGCTGGGCATGG - Intergenic
1103596115 12:122025109-122025131 CTTTTTGGGAAACTGGGCCAGGG + Intronic
1105306717 13:19174105-19174127 CCCTGGGGGAGACCTGGCCAAGG - Exonic
1110394502 13:75013847-75013869 CTGTATGGGAACACTGACCAAGG - Intergenic
1113429804 13:110240327-110240349 CTTGGTGGGAAACCTGGCTAAGG + Intronic
1119036274 14:71232477-71232499 CTCTTTGGGAAACCTAGACCTGG + Intergenic
1119433469 14:74583331-74583353 CTGCTTGAGAAACCTGGCCAAGG + Intronic
1121958488 14:98236745-98236767 CCCTTTGGCAAGCCTGGCCATGG - Intergenic
1125210287 15:37206901-37206923 CTAGATGGTAAACCTGGCCAGGG - Intergenic
1125289528 15:38130478-38130500 CTTTAAAGGAAACCTAGCCAGGG - Intergenic
1125521340 15:40349354-40349376 GTCTATGGGGAACCAGGACAGGG - Intergenic
1127030767 15:54859460-54859482 CTTTGTGAGAAATCTGGCCAGGG - Intergenic
1127935746 15:63636025-63636047 GACTATGGTAAACTTGGCCATGG - Exonic
1128684339 15:69672400-69672422 ATCTGTGGAAAACCTGGTCAGGG + Intergenic
1128871245 15:71156881-71156903 CTGAATGGAAAACCTGGCCAAGG + Intronic
1129960538 15:79680689-79680711 TTCTAAGGGATACCTGGACATGG + Intergenic
1130172973 15:81535772-81535794 CAGTATGGGAAAGCTGGCTAGGG - Intergenic
1131449707 15:92529083-92529105 TTCTATGGGACTCCTGGGCAAGG + Intergenic
1131980889 15:97993626-97993648 CTGTATGTGAAAGCTGGCGAAGG + Intergenic
1132024928 15:98397390-98397412 CCCTATGGGACAGCTGGACAAGG + Intergenic
1134657749 16:15959885-15959907 CTCTCTGAGAAACCTGTCTAGGG + Intronic
1136556355 16:31010012-31010034 CTCTTTGGCAAACCTGCCCAGGG + Intronic
1137917133 16:52444260-52444282 TTCTAAGGTAAACCTGGGCAGGG - Exonic
1138157598 16:54720573-54720595 GTCTATGAGAAGTCTGGCCAGGG + Intergenic
1138474685 16:57263782-57263804 CTCTCTGGAATCCCTGGCCACGG + Intronic
1140101599 16:71922413-71922435 CTTTCTGGGGAACCTGGCCTTGG + Intronic
1140699380 16:77567148-77567170 CTCTATGGCACTCCTGCCCATGG + Intergenic
1141914256 16:87083438-87083460 CTCTATGGGAAGCATGGGGAAGG + Intergenic
1143614502 17:8041798-8041820 CTCTATGGGACACCTACCAAAGG + Intronic
1146755763 17:35430695-35430717 GTTTATGGGAACCCTGGGCAAGG - Intronic
1148330157 17:46809398-46809420 CTTTCTGGGAAACCTGCCCCTGG - Intronic
1148787668 17:50153220-50153242 GTCTTTGGGAATTCTGGCCAGGG - Intergenic
1149449714 17:56740046-56740068 GTCTCTGGGAAAGCTGGCCAGGG + Intergenic
1150005865 17:61468749-61468771 CTGTATGGGAAACCCAGCAAAGG - Intronic
1151505178 17:74522689-74522711 CTCTTCTGGAAACGTGGCCAGGG + Exonic
1155180143 18:23337967-23337989 CTATATGGGAGACATGGTCAGGG + Intronic
1156953156 18:42929850-42929872 CTCTCTGGGGCACCTGTCCATGG - Intronic
1161029087 19:2049768-2049790 CCCTAGGGGAAAACTGGGCAGGG + Intronic
1161241733 19:3226796-3226818 ATCTCTGGGAAACCTGGGCACGG + Intronic
1164788469 19:30956554-30956576 CTTTATGTGAAGCCTGGCAAGGG - Intergenic
1165062648 19:33212371-33212393 CTCCGTGGGACACCTGGCCCTGG - Exonic
1166346289 19:42168149-42168171 CAGTCTGGGAACCCTGGCCAAGG - Intronic
928205647 2:29281340-29281362 CTCTGTGGGCAGCCTGGTCAAGG + Intronic
929959484 2:46485518-46485540 CTCTATTAGAAAGCTGGACATGG + Intergenic
933048487 2:77570913-77570935 CGCTCTGGGAAACCTGGACAGGG + Intronic
933852562 2:86382340-86382362 CTGTATGGGAAATCCGGCCAGGG + Intergenic
942086021 2:172444714-172444736 TCCTATGTGAAAACTGGCCAGGG - Intronic
944271898 2:197793650-197793672 CTCTTTGGCACACATGGCCATGG - Intergenic
945704202 2:213208949-213208971 GTTTATGGGGAACCTGGCTAAGG - Intergenic
946296745 2:218790395-218790417 TTTTATGGGGAACCTGGCTAAGG - Intronic
947704379 2:232262474-232262496 TTCTAGGGGAAAGCTGGCCCAGG - Intronic
947974691 2:234355525-234355547 CTTTCTGGGAAACCTTGCCCTGG - Intergenic
948631680 2:239306801-239306823 GTGTGTGGGAAACCAGGCCAGGG - Intronic
1171386256 20:24771063-24771085 GACTCTGGGAAACATGGCCATGG + Intergenic
1171526618 20:25817793-25817815 CTATGTAGGAACCCTGGCCATGG + Intronic
1171550209 20:26038092-26038114 CTATGTAGGAACCCTGGCCATGG - Intergenic
1174157645 20:48527032-48527054 CTCTGTAGCAATCCTGGCCACGG + Intergenic
1174719350 20:52795185-52795207 CTGAATGGGAAACAGGGCCATGG + Intergenic
1175880065 20:62252718-62252740 CTCTACGGGAAACATGGCGCTGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176000944 20:62830841-62830863 CCCAGTGGGAAATCTGGCCATGG + Intronic
1177451833 21:21278674-21278696 CTCTCTGGAAAACTTGGGCAGGG - Intronic
1178774395 21:35535626-35535648 CTCTCCGTGAATCCTGGCCAGGG - Intronic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1183403132 22:37616580-37616602 CTCTATGGCAAGCCAAGCCAAGG + Intronic
1184073919 22:42164042-42164064 CTCTGGGCGAATCCTGGCCAGGG - Intronic
1184784949 22:46667119-46667141 CTAGCTGGGAAGCCTGGCCAGGG - Intronic
1184866035 22:47202358-47202380 CGCTTTGGGGGACCTGGCCAGGG - Intergenic
1185100872 22:48840254-48840276 CCCTGTGGGAAACCTAACCAGGG - Intronic
950012540 3:9733191-9733213 CTTTATGGGGAGCCTGGCCCTGG - Intronic
951530148 3:23691366-23691388 CTCTATGGGAAGCATGGCTGGGG - Intergenic
952211437 3:31232412-31232434 CTCTGTGTGACACCTGGGCATGG - Intergenic
952453645 3:33453388-33453410 CACTGTGGGAACACTGGCCAAGG + Intergenic
955032365 3:55233588-55233610 CCAAGTGGGAAACCTGGCCAGGG + Intergenic
955312189 3:57900477-57900499 CTGTTTGGGGAACCTTGCCAGGG + Intronic
960965195 3:123099758-123099780 CTCTGTGGGAAACCCCTCCATGG - Intronic
961045216 3:123703428-123703450 GGCTATGGGATACATGGCCAGGG - Intronic
961337377 3:126189406-126189428 CTTTAAGGTAAAGCTGGCCATGG - Intronic
961939951 3:130626703-130626725 CACCTTGGGAAAGCTGGCCAAGG - Intronic
962628401 3:137250162-137250184 CTGTATGGGAAAGCTGGCCAAGG - Intergenic
965084232 3:164073625-164073647 GTTTATGGGGACCCTGGCCAAGG - Intergenic
969077691 4:4593315-4593337 CTCTGTGGGAAACCAAGTCAAGG - Intergenic
971819531 4:31533384-31533406 CTTTATGGAAAATCTGGCCAGGG + Intergenic
976133670 4:81911982-81912004 CTCTAAGGGGAAGCTGGCCTTGG - Intronic
978479880 4:109176891-109176913 CTCTAGGGGAGATCTGGCCTTGG - Intronic
982971908 4:161999068-161999090 TTCTAAGGGAAACTAGGCCAAGG + Intronic
984283140 4:177696571-177696593 CTCTGTGGAAAATCTAGCCAGGG + Intergenic
985001756 4:185492016-185492038 CTCTATGGCAAACCTGGAAATGG + Intergenic
986124805 5:4875065-4875087 CTCCATGGGAGAACTGGCCAAGG + Intergenic
988316407 5:29635232-29635254 CTACATGGGAAAACTGGCCAGGG - Intergenic
989754383 5:44935529-44935551 CTGTGTGGTAAAGCTGGCCAGGG + Intergenic
997184674 5:131869807-131869829 CTCCATGGGAACCATTGCCAGGG - Intronic
997271610 5:132544170-132544192 CTCAATGGGAAAGGTGCCCAAGG - Intronic
998479050 5:142446005-142446027 CTCTATAGGAAGCATGGCTAGGG + Intergenic
998593342 5:143501326-143501348 CTCTATTGCAAAGCTGGCCCAGG + Intergenic
1001048243 5:168392300-168392322 CTCTACTGGAAATCTGACCAGGG + Intronic
1003381504 6:5628652-5628674 CTTGATGGGAAACGTGGCCGGGG - Intronic
1003668466 6:8133139-8133161 CTCTTTAGGAACCCTGGGCAAGG - Intergenic
1003684849 6:8292289-8292311 CTCCATGTGGACCCTGGCCATGG - Intergenic
1005435000 6:25799975-25799997 CTTTATGGGAAATGTGGCCATGG + Intronic
1006402400 6:33825466-33825488 CTCTCTGGCAAGCCTGGCCCTGG - Intergenic
1008451929 6:51661941-51661963 ATCTATGCTAAACCTGACCATGG + Intronic
1010791036 6:80065468-80065490 CTTCATGGAAAACCTTGCCAGGG + Intergenic
1010866158 6:80978723-80978745 CTCTAGGGGAATCCTGGTCTTGG + Intergenic
1014980247 6:127937611-127937633 CTCCATGCAAAAACTGGCCAGGG - Intergenic
1021153473 7:17180235-17180257 CTTACTGGGAATCCTGGCCAAGG - Intergenic
1024185693 7:46945978-46946000 TTCTATGGGAAACCACACCATGG + Intergenic
1024216914 7:47255806-47255828 CCCTATGGGAAACCTGCCTGGGG + Intergenic
1024765028 7:52647687-52647709 CTCAGTGGGAAACTTGCCCAGGG - Intergenic
1025299052 7:57802141-57802163 CTATGTAGGAACCCTGGCCATGG - Intergenic
1025958415 7:66200191-66200213 CTCTAGAGAAGACCTGGCCAAGG - Intergenic
1026915906 7:74120429-74120451 CTCTATGGGAACCCAGGCTTAGG - Intronic
1028357772 7:89930045-89930067 GCCTATGGGAAACGTGGCCTTGG - Intergenic
1029421475 7:100474133-100474155 CTCTTAGAGAAACCTGGCCTGGG - Intronic
1029693171 7:102196017-102196039 CCCCAGGGGAAACCTGACCAAGG - Intronic
1031500559 7:122509540-122509562 CTCTATTGGAAAAATGGCCAGGG - Intronic
1033094568 7:138419219-138419241 TTCTATGGGAAAACTGGGCCAGG - Intergenic
1034337213 7:150331254-150331276 CTCTAGTGGTGACCTGGCCAAGG + Exonic
1036056766 8:5263494-5263516 CTGTGTGGGAAATCTGGGCAGGG - Intergenic
1037488366 8:19372366-19372388 CTGTGTGGGAAAGCTGGTCAGGG + Intronic
1038171198 8:25134454-25134476 CTATATGGGAAAGGTGGACAGGG + Intergenic
1040588086 8:48763272-48763294 CTCCATGGGCAACCTGGGCCTGG - Intergenic
1041334985 8:56772046-56772068 CTCTATTCAAAACCTTGCCATGG - Intergenic
1041827814 8:62117705-62117727 CTTTGTGGGAAAACTGGCCAGGG + Intergenic
1042043316 8:64619390-64619412 CTCTTTGGAAAACATGGCAAAGG - Intronic
1046841154 8:118858573-118858595 CCCTATGGGCCACCTTGCCATGG + Intergenic
1047445437 8:124915037-124915059 TTCAAAGGGAAACCTTGCCAAGG - Intergenic
1047585629 8:126268944-126268966 CCCTCTGGGAAGCCTGCCCATGG - Intergenic
1049151492 8:141037972-141037994 CACTAGGGGAGAGCTGGCCACGG - Intergenic
1049974535 9:849037-849059 CCCTATGGAAAACCTGGCACTGG - Intronic
1051487629 9:17625863-17625885 CTTCATGGGAAACCTGTCCCAGG + Intronic
1051574061 9:18595139-18595161 CTATGTGGGAATGCTGGCCAAGG + Intronic
1057903369 9:98966240-98966262 CTCTAAGTGAAACATGGCCTGGG - Intronic
1062704063 9:137925084-137925106 CCCCAGGGAAAACCTGGCCAAGG + Intronic
1186695801 X:12030557-12030579 CTCTATGGGCAATCTGGGAATGG + Intergenic
1186711488 X:12202546-12202568 CTTTAGGGGAAGACTGGCCATGG + Intronic
1188418463 X:29967371-29967393 CTTTATGAGAAAACTGGACATGG + Intergenic
1188895151 X:35658687-35658709 CTGTGTGGGAATGCTGGCCAGGG + Intergenic
1189001659 X:36954375-36954397 GTTTATGGGGAACCTGGCTAAGG + Intergenic
1192289684 X:69780804-69780826 CTGTATGGGAGACATGGCTAGGG - Intronic
1195196370 X:102501234-102501256 CTCTATGGGGAACCCTGCAAGGG + Intergenic
1198347296 X:135771138-135771160 CACCATGGCAAACCTGGCTACGG + Intergenic
1198349202 X:135788399-135788421 CACCATGGCAAACCTGGCTACGG + Intergenic
1198351107 X:135805672-135805694 CACCATGGCAAACCTGGCTACGG + Intergenic
1198353014 X:135822937-135822959 CACCATGGCAAACCTGGCTACGG + Intergenic
1198354923 X:135840192-135840214 CACCATGGCAAACCTGGCTACGG + Intergenic
1198356833 X:135857475-135857497 CACCATGGCAAACCTGGCTACGG + Intergenic
1198358746 X:135874754-135874776 CACCATGGCAAACCTGGCTACGG + Intergenic