ID: 1064308810

View in Genome Browser
Species Human (GRCh38)
Location 10:14193067-14193089
Sequence ATTCTACCCTGGGCCATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064308807_1064308810 18 Left 1064308807 10:14193026-14193048 CCTTGTCAATATCTAGGTCAAGT 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1064308810 10:14193067-14193089 ATTCTACCCTGGGCCATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064308810 Original CRISPR ATTCTACCCTGGGCCATCCA TGG Intronic
No off target data available for this crispr